Description :
From Genome Similarity Track
Location :
Scaffold_606:9210- 12705
Sequence
3495 bases(100 bases per row)
TTGTCTAAAACTGTGACGGGGTCACACAGCACCCTGCGCTAGAGGAAGTTAGCTTCCGAGAGTATACAACCTCTCAGTGAACGACAGCTCACAGGCACCC
TCATTATCAAAAGGGAGCGAAGTGACCTATTGAAAGTAAATTGTAAACTGATTATATGTATAGGTAGATAAAGCTTGGGTTTAATACAAACAATAAGTCA
CCTATAAAAAAGCAATGCCATCAGCCAATGGTTGGCTTTGGACGACGGAGTATGACGTGTCATACTTCTGAAGTGAGACTTATCACACTTCATGTAACTA
GGGGTACACTTAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTCTACCGACCAATCAGAATGAAGAAGGGTTCGTCATAAACTTTCATT
CTCAAAGTCGAAAACCATCGACTCCGCCGCGCTCGCGCGGCGGAGGCTTACTTCACAGTTAAAGCCTCGAGCAGCAGTCTGTGCGCTCTTCTTCTAGGTC
TCCACATCGACCGTTTACCATGCCTCGTGGCACTGCAAAGAGCGGTGCGAAGACACGCTCTAAGGCTGCTGCCGGAAAGGTGCAAGCCAAGAGCACTAAG
CCTCACGGCAAAGGATCGGCACTTCAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGTTCCTCGAGTGACGCGGTTGTGGGCAAGCGAGCAAGCAAGC
GCCGCAGCACGTCGCCCTCGGCCTCTCCAGACAATCGTCCGAGCCCTCGGTTCGTTGAACGTGAGCTCGACTCTGGCAGGAAGGACGAAGCCGAGTCCGA
GAGCACGCACGATGCTCCTGCAGGGCTCTGCGGGAGGGCACAGCCCAGTGCCCAGCGAGTACAAGGACGACAGCGTGCAGTCGCTCGCTAGTGACCAAGG
TGATCACAGTCCCAGGACGTCTGTGCGCTCTGAGAGTCAGACCATCAAGGCTAAGGGCACTCCCAAAGCTGGTGGCGATGAGAAAGGGAAACCTCACAAA
CGTCTCTCGCTTGCCGAGGGTCTTGCGCGTGCTAAGGCCCCCAAAGCCAAAGGCGCCAAGCCCTCTAAGAAGCGTACGGCTTCTAAGTCTCCACTCCGCG
AGGAGAAGGAGACTCGGTACTCCCATCGGGGCCTCTTCGACTCCTCGGATGAAGAGGAAGAGAAGGACGAGGAAGAGGAAGAGAGGAGGGTGCTATCTCT
GAGCCCCGTGAGATCACGAATAACCTCGACCAGCAGCAGGAGGACTTCCAAGCTGCCCAGCGTGTGCGTGGGGGATCGGTGGTGGCATCCGTCAGCCAGG
GAGCTGCCATCATCTCGCGAGGGTATTGGCCTCCCGAAGAGAGCTCTGGAGCTGACCTCTTCCTGGAGCTTCTCGTTGCTCCTCGTGGCCTTGTTGGCAG
CCACACCTCTAGGGGTATTTACGAGCGCACTCTTGTTCAGAAAGAACAGTTGTTCGTTGACAACTTGGAGGCTGCTCGGTGTGTGCTTCTCGCGCCACAC
CGCATCCCCCTTAAGGACTTTACTACGTGTCGTAACAAGCCCAAGAACCGGGGTGGTCTCTATCCTCTTTGGGGATACCCCTGGGTTCTGCCCGAGAACT
GTCCCGCCCGGGGTTCTTGTGAGGACATGTTCTGGGCCTGGGTGGAGTCTCTCAAGTACTCACCCACGGAGTTACGAGAACTCCATAAAGATCAGCTGCT
GTCCCGCATCCTGGTCCAGCGTGATCTTCGTGTTCGGTTCGCCCACATGGTCAGCAAGCGCATGCTGCCAAGGGACATCCTGAAGCGTGCGGCTTCTAGC
GCTCACGATGAGCGCGGGTACGGAGTGTCTTCAACGTCCGTACCCCGCTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGCCGCTTCTGTTCCCA
GATTGCGACAGCCTTCGGGCAGTCAATCACGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGACATAACCCCTCCATTTCACGAGGAGCTGTCGC
TTACCGCGACGCCGTTGCTCCTGGAGGATTTGCTTCACGTGGAAGTGTACTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAG
TACTCGGCGCCTCCCGAACGCCACTCTTGTCCGAGTCCTTCTCCTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTCCTCGTGC
TTGAGATTGCACTTGGCCTTGGGACTGGTGCTGATGCCGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCTTAGACCTGTTGGA
GCGTGAGGTCGCGAGCCTGCATCTGCGGGTGGACCGACGGTCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTCTTCTG
CCACGTCCGGAGCCGCCTGCGGCACACTTCCAGACGTACGCGTATGTTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGT
ACGGAGCCCCTCCGGCGTTCAGTCTTGACCGCATCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCTGACGCCCTCGTCGACGTCTGTGGTCGGCCC
TCGCTTCGAGGAGCTGGTCTAAGGTTGGTCTGCGGATCAAAGTACCGCTTAAGACGTGGGGTGCGTCGTCATGACTTAGACAGGTCGATGGTGTACGATG
CTCCGTGTCTGGCCAGGACTGCAAATGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGGGGTAGGCTCCTCGTGTC
TAGTAACACTAAGTCCCCCACTTTAAATACACTTAAGTTTCCTCTTCCATGTTTGTCGGAGTACTCCTTTTGTCTATCCTGGGCTGCTGCCATGGCATCG
TGTACCCTGCTGACACCGCTCAGCTTGGTATCCATAAAGGATTCCACTTGTTCCACATCGAAACTGGTCTCACATCCGAGCCTCTCCCCCACTTAAAATA
GAGGGGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGACGTGAGCCCCGTGGATGCGTGCACCGCGTTGT
TGAGCGCAAACTCAACAGCTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAAGGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTCTGGCCGCCTGTCTGCGGATGGTACGCAGTGGACATCTGCAGACGAGTTCCCAGAATAAAGGGAACAGCGTTTTCCAAAACGCAGCCGCGAATCGCG
GGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAACGGAACACGCCATCGACGAACAACCTTGCGATTTGTTCGCCCGTAACAGTGACGAGAAC
CGGAGCAAGATGTACCATCTTGCTCAGCCGACACAGCGAGCACCAAAATTCCGAGTGTTGCCGTGTTCGTCGGTGGGAAGCCAAAGATGAAGTCA