Description :
From Genome Similarity Track
Location :
Scaffold_239:92082- 94046
Sequence
1964 bases(100 bases per row)
CAAACGCTTGCTGCGCGGGTGGATGATGTGATGTGCGTGTGTTGATATGACTCCATCCGCGTTCCAGCGATCTCCTGAGCCCTTGTTCGGTGCTGGACCC
CGCATTTGCCCGGTCGTTAGCGCAGCAGCCGAGGTAGCAGTGAGCGCATAGTATCAGCGTGACCCATGAGCGTGATCTTTGGAGCTTCATGGCTGATAGG
AAGCGGACTTGACGGGGTAGCGAGTGTGCGTGTCCGGTCGTTGTTGTGTCGGTGATAGGATGGTGTTGTTTCGTGTGTTGGTACAGGATGTATTTTAATT
TGTGTTCTGTTTTTGGCGTGTGTGCGTTAGTGACGTGGCAGCTGCGTTTTGTGGCAAGCTGGTAGTTTGAGTTTGTAGAAGTTGGTGGTTTGAGTTTGTG
GAAGCTGGTGGTTTGAGTTTGTGGAAGTTGGTGGTTTGAGTTTGTGTACGATGTAAGTGTGAAAAGGAAGAGTTACGCCTGTGTGGCTCAGTGGTAGAGC
ATCTGTCTTGTAAACAGAAGGTCCCCGGTTCAATCCGGGGCGGAGGCATGCCTTTTCCACGCTGCTTCTGAACCCGTCTGTCTCGAGACCAGCACACGCG
ACTACAGTGCTTGTTGCTATTGTCCTGGTCATTAAAGAAGATACAACTCAGAAATGTTTTTTAAACATGGCATCAAATCTGCTTATATTTTCGTCAGCTT
TGACCTTGGAGAACCTGGAGTCCTCCAGATTCTATTTGAAGGAGTACTTGTTTATTTAAAGAGCGTTCAGGGCGGCTAACGGAGTGGCATTACGAGAAAG
AATGGGTCGAGGCAAGCCGCTGACCCCTCAAGAAAAGTGCATGATTGTGCAGGCTCATGCATATTTCATTGCTGAGGAAAAAGCAGGACGTTCTGGGGGC
GTGGAGACCCGAGCGGTGCTTCGTGGACCCTGTTCAAGACGACTAGGATATCCATCTTGCCAACGCTGAGTTCGCAGTGAATTCAACCGTGAACAGTAGT
ATCAAGATGGCGCCTTTCGAAGCTGATCTCGGATACGTCCCACTAAACCCGCTTCAACTTGCGGCGGAGAATCGTGGCAAGGTCCCCACAAGTCGACGTG
CTGCTGAGTTCAACGAGCGACAAGCAGCTCTTCTTCGGCGGTGTCAGGAAGCACTGGCGGAAGCGCAAGAGCGAATGCGCGATGTGTACGACCGAAACCG
GGTGGAGCAAGTCTTCGAAGCTGGCGACCGAGTGTACTTGAGTACGGAACACTTAGATCGGAAACCTACAGGGTTACCCAACTCAAGCAAGCTTGGTCCC
GAAGTGGATAGGTCCCTATACGGTGGAGCAGACCATCCATAGCGGAGGTACAACGTAAATTCCAAGCCAAAAAGAGTTGGTCGGGGCGGAACAGGGCGGG
GAAACGACCTGAAATCGACTATTGAATTTTAATTCCCTTATCTTGGGTGGGAGCAAATCTGCAGGTAAAGTAATGCAAAATATAATTGTTGGCGCACAGA
CGACAGTGACCGAGCAAAGAAAATGGGGCACTTGGGGGGCCGGTTAGGACGGGGTTGGAAAGACATATAAGAGGAGAAGAATAAGAAGTAACAGGGGGAA
TTGACCGCATCTGTGCCCAGGCAGGCCTTATGGGTCGAAAAAAAATAAAAAAAAAGATGAAATAGAGAAACTCTATAAGGTGCCTAGGGAACAGATCAGT
TACGGAATTTACAGAGAAGGGAAAGGACATAGCGAATGAAAGGATATGTAAATGAGTTATCCATAGGCAAATAGCAGATAGAGCGGAAGAAAAACTGAGG
GGTGGAGGGGAAATTCTGACGGACAGATTGTAATAAGGGAATAAAGAAATAGAAGGGGTCATTTACTGGCCCGTCTTGAAAAAAAATTTAAAATGTCTAA
TATATATGAATGAAATAATTGGTTTCGATCAATCTAATAAAGAATTTAAACTTGTGGTCACGGG