Description :
From Genome Similarity Track
Location :
Scaffold_614:9207- 10974
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_614-snap-gene-0.115'-AMP-activated protein kinase subunit beta
Pytiw_DAOMBR242034maker-piw_contig_614-fgenesh-gene-0.7UPF0197 transmembrane protein

Sequence
1767 bases(100 bases per row)
GACGCGATGGATATCGACCCACCGTCGTCGTCGTCGGACCTGTCGTTCATGTCCAACAGCCTGCCGACGTCGCAGCTCGACGGCAAGGGCGATACGGGGT
CGCTCGAGAGTGACAACGGCCTCAGCACCAAGAGCGAGGTCGTGCCCATGGTTTTCCGGTGGGAGCACGGCGGACGCAACGTGTACATCACGGGCACGTT
CAACGGCTGGTCGAAGCAATGTCCGATGCACCGGTCCGGTAACGACTTCACGTACATCGCGAACCTCACGCGCGGCAAGCACGCGTACAAGTTCGTGGTT
GACGACGAGTGGCGCTTTGCGCCGGATCAGCTCACGGTCGCAGACGTTGAGGGCAACGTGAACAACTTTGTGGACGTCTCGGAGTTCACGCCGCTCTCGG
ACTTTGAAGGCAACGCGCACCACAACGACGACAAGGACGAGAACGGCGAGAGCACGTACGGCCGGTTCATCCCCGACATTGACGAGTACACGAAGGAGCC
ACCGCCGCTCCCGCCGCACTTGCGGCACATCATCTTAAATAAGGTACGCGTCTTGCGACAATGTTGGGCATATGAGGATGCCATTGTGAGACCACCATCG
TGAGAGCTAACGGCGCCTGTGTTTGATTTCTGTAGACACCACCAACCGTGGATTCGAGATTACTCCCCGTGCCGCAGCACGTCGCGCTCAACCACCTCTA
CTGCACAGCGATCAAGGACGGTATGATGGTGCTCGGGATCACAAATCGGTACAAGCAGAAGTTCGTCACGACCGTGTACTACAGTCTAATGCCCGGCACG
AATTAAGCCAGCGCCAATGAAAACCCCACGAGCAGTTCCAGAAACAGAGACCCAAGCGACTTTAAGTCACGAGAGCTGAGAGCCGACCGTTTTAGAGAAA
CTCACACACACGTTGCAGCAGCCGCCCGACAGGTAGATGGCTGCGCGACTCGTGAACCAAGATGGTCGGGCTTCGTAGCTCGCAACTCGTGGGCGAAGGT
AGCGATTTATTATTTTAGTGAGGTGGAGGCTGGTAGATTTTGACAGCCGTGCGTGCTGTGGACGACTAACTGCTGGTACATGGTGATTGGCGGTATCGGC
TGGTACGAGCTCAGCTCTGCAAGCTCACGAAGAATCGCCTGACTCGCCTCCTTGTAGAGAAAGAAATACAGATACACTTCGGCAGAGCAGCAAAATAGCC
CGACAGCCTCGACCACGTGCGAGCGATAAAGATACAATCACAAACACCAATTCATCGAGAGGCATCGCAATCTGTCTTCACAGCCATCACCACAGAGCCT
CATGAACACGATTCACTGGAAACAAATACAACATCCTTCATTTTTTTAGATCGCTCGTCGACAGGCGACACGAGGGCAACCAGCATTCGCTTCTTCGCTT
CAAAATCGGTCCTTCGCCATGCTCACCGATCGTAGTAGCAGCCCAAATAGTACTGCACTCTATCACTGTGTTCACTCGCGCGGCCGGCTGTCTTGATCGG
CTGTCGTTTCTACCGCATAGTCATCAGCTGCTGCTGAGTGGCGTTTCTAGACGTAGATCTCGGCCCAGAGGAAGAGGAAGAGCGAGCCAAAGCCGAGGAA
GAAGGCGGCGACGACCGCCAGCAGCAGCTCAAGCAGCAGGTTCTTCTTTGGGGCGACGCCCGTGGTGAAGAAGAGCGAGAGGAACGTCAGGCCCGTGAGC
AGGAACAGCACCGTGATACTGCCGTAGTGGTCCGGGTTCACAGGGCTCGTGTACGGGATTTCCTGCA