Description :
From Genome Similarity Track
Location :
Scaffold_12:92059- 94048
Transcript NameFunction/comments
Physo_391009PREDICTED: uncharacterized protein LOC101222344
Physo_262743Hypothetical protein

Sequence
1989 bases(100 bases per row)
CGCTCGTGGAGTGTTCACTCCTTCATCCGCACCAAGCGACGAAATCGGCTGAAACCCGATCGCGTGGAAAAGCTAGCATATTTGTACTCGAATGCGGGTG
ACAAGGCTGCAACCAGTGCAGTGCACTATCACGTCAATGCAGAAGAAGAGGGCGAAAGCAGCGCGAGTGACGACTACAGCGATGATGACGTCGTTACGCC
AATTGCTCCCAACAGCTCCAGTCGCATGCGCGGTAGTCGGTCTAATACGGCGCGCCGATCACGATTCTTCACGCCCTCGCAGACCGACCAACGTGAAGCT
GTCCCACCCCCGCTAGCTCGAAAAACACTATTTTCGCCTGCACTAGCCAACCCGCTACCCGACCAAGCGACGAATACCAGCACAGTATGCAGTGACGAGG
CTGCGGTCGCTCTTACGCAGTCGGTCGCTCTTACGCAGTCGGTCGCTCCTACGCAGTCAGTCGCACTTACGCAGTCAACAAGCAGCGGAACCGTTTTCAC
GCGTGCTGATGAGCGCCAGCTTGTGCCACCGGTCGTGAGGCCGCCCGGATCGGCAAGTGCAACAACACCGAGTCTACCAACTAGCGATCGTCTCGTATTT
TCAGGGGCTAGCAGCGGCCGTCGTGGACTACCTCCAACTCCACAGTCGAGCACTGGACGCACCCACCACTCGCCGAGGGTGCTGTTTGGTCCAACCTGGG
AGCATTAGCATATTTGACTTTGTTCACGCTAGCTAAGCCCGCAACACGATCCATATTTTCATTCCGTTCACGCCTTCTTGATTACATATTATGCACTAGT
TAGTCAATAGAGTCGTCGTCCTCATGCAAATGTGTATCAATGCATTGGCTTCAACCTCTTTCGAATTTCTTCGAGATGCTGCCTCGGCTGATGGTATTTC
TAGCAGCTTCCTCCGCTTCATTTTCTCGTGAGGAGTTTTGGTTCTGCTGCGGAATTGGGTAGTTGTTCATGATAGGGGTAGACTTGATGGTGCTTGTCGG
ACGTGACGGCATATTCGTCGTCGCGCTACTCGAGCCTTGATCACTCATGCACGCAGCCGAGGATGTTCGATTTGCTCTTGCCAGCCTCACCACCCTGTTT
CAGCGCGCACACAACCTTTCTGTGCTTGTGCGTGGTGAAGCTGCGTGTGGACCCGTGGCCATGGCGGTCGCAGAACACTTTGGTGACCTTAGTGGTGGCG
AACTTGCTAGGGGTGAAGGAGAGGTGGAGGGCTAAACCGCTTTTGCCCTGACTAATCCGAGTTCAAATAATGCAAACACCAGCTCTTCTTGCTCTTCTTA
TGATCGTAGAGCTTCACATCAGTTAGCTCACATATTCAGTGCATCGTGCCGTACCCGCCGAAACAGGTTGCCCTTCTACGAGATGACCTCAACTTGAACT
TCTGTCACTGAGCTTCCAGCGCAACGGCGCACATTGGCACAGCAGAACGCGCACTAGCACTCCCACAAATAAAGAAGCGTCATATTTGGTTAAGAATGCA
GTAATAATGTAACATCAACGCTTGTAGCGCAACATTTAGGCCTCGTCCAACCCTTATCAGCGAGCTGTTCGTTCATGTAACAGCATAATGGCCACCTCGG
CGATGTATATGAAACTCTTCAAGCCCTTCCCTCTCTTACGAATCTGCAGCACAACACACAAACTCATGAGATCCACCATATCCAGCTACACGCTCTCCCA
CCGGCACTTACTTCATTTTTGATGAATCCCTCGGCCAGCAGGCACGTGACGTGGTCCACGTACTGATGGCTAGGCCCGCCCTGCAGGAGATAGGTGTTGG
TGGTGCCGGACTCCGTAGTGCCAAAGAACTCGCAGGTCCTGTCGCTCAGCAGTGAAGCATCGGCCTCGTCCGTCGTGAAGCGCACGCCGCACCTGTTCTC
CTTGGGCACCATGTCGCCTAGTCCGAAGCAACTGCCGGTCGCAACGGTGTACAACTCGGGTGACGCGCCGATGATGTAGACGCCCACAC