Description :
From Genome Similarity Track
Location :
contig_21:92045- 93199
Transcript NameFunction/comments
g4766.t1hypothetical protein

Sequence
1154 bases(100 bases per row)
CATGCTTTTCCCCCAAATATCCCGCCGACTCAGTTGGTTTATTTGGGAGGTAGACATCCGAACCGTACTTAATATTGGTATGGAATACAAAATCAATATT
AAATCATGATATCATCCACTGAAGCACCCATGCTCTAAACCCACCACATCACTGGGTACCGGACTACGCTACTCCTAAGGCGTCAAATGTCTTTTATCGC
TGTAAGGTAGCAGAAAGCTTGGAGTTCCTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGTGGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGC
TACGGCATCGTGCTGTGCTTCATGGATGCCTGGGTCATGGCATCCAATGCGGCCTCAAAATTACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGC
CACAGTATTGTACACCTTGCCAGTCTCCACATGTAGCTCCGCGACACAAGGTCTCCGGCACCGCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCG
CCGGTCGATAGGAAGCCAAAATGTGACAGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGAAAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGC
CTTGCAACCAACAAAGTGCATGTATTTAATACATGCTAGCTACATGAAGTCAGGTGTCGCGCGACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAA
CGGAAACATGCAGACAGCCATCCTTCGGAGCCAGACGGCTCGTTTCTGGTCGATGAATCACTGGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCT
TGCGGCAAGACGGAGCGCCGACGTCGATCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAGGCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGC
GTGCCGGAATACGGACAGATTCAAGCAGGACCGTGCCCCTGTCATACATTTCGCAAGGCTAACCTTGCACCGGTATCGTCTAGAGACGAACGTAGACCGA
GGCCTGGCCCGTGCGTGCGTGTTGCGCTGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTCTCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCT
TCGCATTTCGCAAGTTACCACCAAGGCCCAAAGCCGAAATGGGAGTGCAACCTG