Description :
From Genome Similarity Track
Location :
contig_21:92042- 93539
Transcript NameFunction/comments
g4546.t1hypothetical protein

Sequence
1497 bases(100 bases per row)
AAATATCCCGCCGACTCAGTTGGTTTATTTGGGAGGTAGACATCCGAACCGTACTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGATATCA
TCCACTGAAGCACCCATGCTCTAAACCCACCACATCACTGGGTACCGGACTACGCTACTCCTAAGGCGTCAAATCTCTTTTATCGCTGTAAGGTAGCAGA
AAGCTTGGAGTTCCTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGTGGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATCGTGCT
GTGCTTCATGGATGCCTGGGTCATGGCATCCAATGCGGCCTCAAAATTACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATTGTACA
CCTTGCCAGTCTCCACATGTAGCTCCGCGACACAAGGTCTCCGGCACCGCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGATAGGAA
GCCAAAATGTGACAGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGAAAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACCAACAA
AGTGCATGTATTTAATACATGCTAGCTACATGAAGTCAGGTGTCGCGCGACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACATGCAGA
CAGCCATCCTTCGGAGCCAGACGGCTCGTTTCTGGTCGATGAATCACTGGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAGACGGA
GCGCCGACGTCGATCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAGGCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAATACGG
ACAGATTCAAGCAGGACCGTGCCCCTGTCATACATTTCGCAAGGCTAACTTTGCACCGGTATCGTCTAGAGATGAACGTAGACCGAGGCCTGGCCCGTGC
GTGCGTGTTGCGCTGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTCTCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTCGCAAG
TTACCACCAAGGCCCAAAGCCGAAATGGGAGTGCAACCTGAAGTCTTGCCACTTCGTGTTCAGCGATCACAGCCGCGGCCCGCCAAGTCCCCGCGAGGTC
TCTCAAAGCGGCCGAGTTTCCGCCGCTCCAAGTCCCTACCCATTGAACTCCCAGAAGACGTCCGCCTGCTCAAGCAGAAGATCCTCGATACACACCCGGC
CAAGCTGACGCGCTTCAGTCTGAGCCACATGCGCCACAAGGCTATCCCACCCGTACTCATCCCAGACACCCTGAGCGACCGACGAGCCATGCGAACGCTC
GTCTCCGGCAAGACCGTGCCGCTCACCATGCACATGTGGGATAACTGCAAGAGGAAGACCAAGCACCTGGATATGATCGACGAGTACGTCACCTACC