Description :
From Genome Similarity Track
Location :
scaffold_19:92039- 94213
Transcript NameFunction/comments
Plaha_PHALS_09601non-selective cation channel-2 family
Plaha_PHALS_09602calcineurinlike phosphoesterase

Sequence
2174 bases(100 bases per row)
GAAATCATGAATGAGGATGAGGAAGATAGCACAATATTCTCTGAGGCAATGGAAGATGACAAGGATGAAGTAGTCGACCGAGATTTGTAGAAAGCAGACT
TCGAGCAGGCAGACACATTGACCGTCGGATAAGTTGGTCTTATTTCCTGCGTAGAACATGACATTAAATGTATTTTGgtcctggcgaaagcacctAACCA
TTATTGGTGTCCTTCACACGTTTGAGAAATTGTAGATATGAAGAGTGTAAAGTATTGACTGTATTGTGGGCGATTAAACCAGATGTTGACGCAATAATTA
TGTGGGGTGAGTTACGTCCACGGAGGCAAGATAACTTGATCGTACACAACACCATTGCGATTCAGAACGAATTGTATAGTCAAAGAGACTTCCGTCGATT
CGATACGAAGGTAGCCCCATTCCCTTACGTGGCTTACACTCCATTCGCCAAGTTTGCTTGAAAAATTTTGCACTTCCAAACCGGCGCCAGCAGATCCAAT
CACTATATGAACGGGTCCCTTGTCATCCTTGGTGCATTTTCCGTTGCGCACAGCACAGCTACGCTCGTATGAGTGCTGATGTCCCACTAACATCAAGTTC
ACTTTGTAAGTCCAAAGCAAATCTTCCACTTCATCACGAAAGTGCTGAGCCACTTTGTAGTCAGCTTCTTCGCCTAATTGTGTAGTGTACATCATTCGGT
GGGACGTGAGAATGACCCACGGAGTCTTCTCCCGATTCAcgtacttcaaatcatctTCTAACCATACGTATTGCTTTGACCCACGACGCCAATCGTGCTC
AGTTGAAATCTGGATAACGTGAATACCACCATAGTCAAAAGAGTACCAATAAATTCCGTTGCCATTAGCGGGAGCATCCCAGCGGTAAAACATCGGTACT
GAGCATTCACCAGACGAGTCCTCACCGTAATTTGCCCACTCTGGGTGAAATGCCATTCGGCCATCGTCACCTGTAGCTCCGCTAGGGTCATTTACGCCGC
CAGTCACGTAATCATATTCGTGGTTGCCAATGCTAACCATATACGGGACTCTCGTAGCATATGGCTCAATAACATGAAAAAATTCATCCCATATGTGCGC
GTGACCACGGGCGTAACTTATGTCGCCAAAGTGCAAAAGGAAGCTATCATAGCCATCCATCACATCCTGAAACGATCTTACAGCAGTGGACGTAGCTGCA
GGAGCTGAGTCTACGCCCATGTCAGCGTACGCAATAAATTTGGCACTTTTTACAGCCTCATCCGGGCGGCTCATGAAAGAATAAATCGAGCTCCAGCCGT
CCTTGTCACTACCAAACTTATAATAGTATCGCGAGCTCAACTTTAGACCGTTGAGTATGACTGTATGCATATAGCCTGGATCACGAAACCACTGCTGGCA
AGTTAGGTTGGCTGGACGGTGGCACAAATGAGCAGCCGTGTATGTCTTCGACGAACCCTCCTCACGCATGTTTAATTGTGCAGGGTCAAATCCGTACTTG
ACTACAGGCGTCTCTCGGGAGGCCGAGTTAAACATTACAGACATCTCATCAATGTTTTTTGTTAAAGCGATATGTCCATGCTTAGGGGCCGTAAAAGCAT
CGGTCATCCCAATTTCCAGCCTGGCAAGAGGAACATAGATGTTACCTTTTGGCAAGAAATTAAAATACTCGACTGTATAGTTGCAGCGCATCATAAAAAG
CGATGGGAAGCGTATCGATTTAAGTGGTTTCATAGTATCAGCTCCCGGTCCATCAGCTTCCGCGACGCCAATCTCGACCAAAAAGTCCCTATCATGCGCC
TTGGGGCCGCAACTAAGACCTACGAAATCTGTCTGATGCGGTCGCTTCACCCCGCTCCAAGAAATAATCAAATCCTCACCATCCCTCAGCAGTGGCGGCG
TCGCAGCCAGTGTAATGTTATCTATTTCCTTTATCATATCATCATTTTCTATCCTAGACAAAAAAACATATTTGTTGTCGCGCTTGATGTCCCAAGGACT
GTTTTCGCTTTGGATAATGGGACGCGGCTTTTCGTCAGATACATCTCTTAAAGCCTTTGAAAACTTGTAGCTTGAGTCAGGCTTCTCTGTTAGTACACAC
GAAGGCAGGTGGATCAGGAAAATGAGTAGCGAAAGCAGGGTAGCGATCATTGCTCGCAAAAGTTTCTTCTAAAA