Description :
From Genome Similarity Track
Location :
Scaffold_9:920362- 921638
Sequence
1276 bases(100 bases per row)
AACGGATCCTGGACGATGGTTCGGCGGACAACGAAAGCTCTGCCAATCGGATGTCGGTGGGTGTTCGCGAAGAAGCGCAACGAGCACGGCCGAGTCATCA
GGTACAAAGCTCGGTTGGTGGCAAAAGAGTTCAAACAGAGGTTTGGCGTACGCTCGGTTGTGGTAGCCGAGGCTTACGTGACCGAACAGTTGGATGCGGA
CACGGCATTTCTGAACAGTGATCTCACTGAGCTTGTCTACATGGAGGTGCCGTATGGCATTACGAACGCGAGGAACATGATGTGCAGACTCGAGAAGGCG
ATCTACGGTCTGATGCAGGCGGCGAATGCTTGGCACAAGACTATCCACCGAGTCTTCATGAACATCGGATTTCGAAGTTGCGGTGCGGACCAGTGCGTCT
ACGTGAAGGGCAAGGACGGCAGGTATGTGTACGTATGCCTCTACGTGGACGACATGATCATCGCGGCCAAAACGAAAAAGGAAATTGAGGAAGTCAAGGT
GGCACTTAAGAGCTCGTTCAAGATGAAGGATCTGGGCGAAGCTTCGTTTATCCTCGGGATGGAGATCCACCACGACTACTCGACCAAGATGCTGATGATC
AGGCAGACGCGTTACATTGACGACGTGGTGAAGAGGTTCAACCAGCAGGACGCCAAGGTGGCGGAAACCCATGTGAGTCGGGCATGAAGCTGACGAAGGC
TCAGCAACCGAAGACTCCAACCGAACTTTCGGCAATGCAGCCGAGACCTTACCGAGCACTCGTCGGATGCTTGTTGTACATCACCACGTGCACTCGTCCG
GATGTAGCTTACATAGTCACGCAGCTGTCACGTTTTCTGGAGAATCCCGGGCAGCAACATTGGAAGGCCGCGATCCGAGTACTGAGGTATCTGAAGGGTA
CCCGAGACCGAGGTATCGTTTACAATGGCAACGAAGGCGAGGTTTCGGTTGAGGCGTACACAGACCCTCGACGACCGTCGCTCGGTGTCGGGAACGATGG
TGATGATCAGTGGAGCGCCGGTGATCTTCAAGTCGAAGTATCAGCGCACGGTGGCGCTAAGCTCGGCGGAGGCCGAGTACATGGCACTCAGCCTATGTTC
CCAGGAGGTGCTGTGGGTCCGCGCCATGTTGAAGGACTTGGGTCATGAGCAAGTGGGAGCTACTCAAGTGTGGGAGGACAACCAAGGTGCGATCTCGCTG
GCGAGCAACGCAGGCTACAATGCTCGGACGAAGCATGTCGACATCACGCATTACTTCATCAGAGAGAACGTGGCGC