Description :
From Genome Similarity Track
Location :
Scaffold_32:92023- 95779
Transcript NameFunction/comments
Phyke_g1854hypothetical protein
Phyke_g1855hypothetical protein PHYSODRAFT_350798

Sequence
3756 bases(100 bases per row)
GCGTACACGTCGTATTCGTACAGCTACTCTACGGTGCTGGACAAAGAAGGTCATCGCATTGGCACCTCTCGTCGACGTTATGAGGACTCGACTGGATGTT
TGAAGGCGTTGCACGAACGCGAGATagacggcaagaagctgaagacgGTGTGGAAGCGGTCCGACACGAAGGATGAAGGTAACTGCGAGACGATTTGCAC
GACCAGCAGCGCGGAGGAGTTCGAGAAGGAATGGCTCAACACACCGTTCGGTCGTGCAGAAGACGAGGAACAGACTAAGTGGATGGAAGAACGAGAGCGA
CGCGTGTACGAAGCTTTTGGCATGGAGTACAAGGCTCTCGAATCTGCGAAGGCGACATCAGAGGAAGTGattgtggaggaggtgaaggagcGGAAGGATG
CGATCGAAAAAGCTTcaaagaagcaggaggaggagacgacgcCGCCACAGTACATGTCGTGAGGGGAGTATGGATGTTATGCATGTTTTATTTTGTCATA
GCAATTGCCAAAAGGCCAAAAGGCCAAAAGGCCGAAAGCCCTAAATACAAATTACTTTAATTTGCTCGTCTACGGACTCTGGTGCTTGGATTTGCTGTAC
TTTATTATATCGTACTTAAATGAAGGATAGTTGTACTTCAGTTTTAGCCTCGCGGATTGTGAAGCACCGCTAGTCACAGATCGTCAGGCTCAGATCGTGT
CACAGATCGTCAGTCACAGATCGTGCCTGAAGGACGTACGTCGCCCCCTCGTGCCTAATGGAGGACCATAACGAAGAGCCGATGCTAAAGCGCCAACGCG
TTACCGAAGCTGTGGACGCAAATGGCTCGGCTGCTTCTTTCCAGCTCAATGGCTTGGGCGTGGATGCCACAGCGGGTGAGTCAAAGCGTTGGCTGGCGAG
TCTTGAGAAATGTATGCGAGCGATCGTCAGTATCCGTCTGCTGAGTGTCCGAGCGTTCGACGGCCTTGGCGCATCCTTCAGTGTGGCTACAGGCTTCGTG
GTGGACTTGGAGAGGGGTCTGATCCTCACGAACCGCCACGTGGTGACGCCTGGTCCCGTGGTGGCAGATGCTATCTTCCTGAACAAAGAGGAGGTGGATC
TAGTGCCTGTATACAGAGACCCAGTACACGACTTTGGGTTCTTTCGCTTTGACCCCAAGAAGGTCAAATTCCTGGAGCTCCATGAAATTCCTCTACGtcc
tgaagctgccaaaagtAGGGAGTTTCCTGTTATTGTTGTAGTTGTTTTCGTAGTGTGCTAGATTTATTGACATTACTTTTTATTGTTGTGGTGATTTTTA
CTTCTTTTATTGCAGTTGGAGCGGAGATTCGAGTTGTTGGGAACGATGCAGGAGAGAAACTGTCAATTCTGCCAGGGATCCTGGCCAAGTTGGATCGAGA
TGCGCCATCTTACGGATCGAGCTCGTACAATGACTTCAATACGTTTTACTATGCAGCAGCCAGTAGTACAAGCGGGGGATCCAGTGGTTCACCTGTACTG
AATATTGATGGCTGCGCCATCGCCCTTAATGCTGGTGGATCCAAGAAAGCGGCGTCGTCATTTTACCTGCCTTTGGACCGCATCGTGCGGGCTCTTGCAC
ACATTCAGCAAGGCCAACCGGTGCCGCGTGGCACTTTACAGACCATCTTCCGCCACACAGCGTTTGATGAGGTGCGCCGCCTCGGACTGTCGGCAGAAAC
GGAAGCTCTAGTACGGCAGCAATTTCCACAAGAGACAGGCATGCTAGTGGTGGACCAGGTCATCCAAGGGGGCCCAGCGCACGACCAACTACGTTCAGGG
GACGTGCTAATTAAGTTTGCTGGCCAGTACGGGACGTCATTTCTCTCGATTGCGGAGTACCTGGATTCACACGTTGGCGAGACTGTGGAGGCCCACTTCC
AACGTGGAGAGGAAAAGTATACATCCACGTTGCAGGTCCAGGACTTGCACTCCATCACTCCTGACCGTTACTTGGAGATCGGAGGCGGTATCGTCCATGC
GCTCTCCTACCAGCAAGCACGAAATGCGTCATTACCAGTGGGTGGCGTCTATTTAGCACAAGCAGGCCACATGTTTATGAAGGCTCACTTGGCCCAGCCT
TGCATCATCACGGCAGTAGCAGGCAAGCCCACCCCGACACTTGACGACTTTGCTCGTGTCATGGCCACTTTGCCCAATGGTTTTCGGACAGTATTACGGT
ACTTTATGATTCGCGACCGCCACCGGATTCGTACGGCCTTCATCATGATGGATCGTCTTTGGTTCCCCATGCAGATGTGCACGCGCAATGATGGCGATGG
ACTCTGGCATGCGAAGCCATATGCACAGGACAGTACTGACTCAAAACTCTTGGACACTGTCAACGGAAACCCGACGTTCGCACCCGCGCCATTGAGCTTT
CCCGGAGGCAGCGCGCTGGGTAAGAAGACACTACTATCGTTGGTAATGGTGTCATTTGACATTCCTTATATGATTGATGGCATCTCGAGCTCGACCTATC
ATGGGATGGGAGTCGTCGTGGATGCAGAGCAAGGTTTCGTACTTGTGGACCAGAATACCGTTCCCATCGCATTGGGCGACGTGTTGATTACCATTGCCGC
TACTGTGGAAGTGCCCGCCAAAGTGGTGTTTGTGCACCCAGTTCATAACTTTTCCATTGTCCAATATGATCCCAAGGCCctgggtgctgctgccagtcaC
ATTGGAAGTGTCGTGCTGGCCGAAAAGCCGCTCGAGGTTGGCGAGACTGCCGATTACATTGGACTGAGCAGTAACTGGACCGTCGTTACTATGAAGTCCG
TGGTCACCAAGCTAGATCGCCTCGTGCTGCGTGATTTCCAGCCTCCTCGCTACAAGGCGTGCAACGTCGAGGTGTTGCACTTTGACCGCATCACCAAGTC
CGTGGGTGGTGTCTTTATTAACGACGAAGGTGCCGTTAATGCACTTTGGCTTTCTTTTAGCTACCAGGACAATGCTGGACGAAAAGAAGTTTTCCGAGGT
CTACCGGCCAGTATCGTTCGGTCCACCATTGACGAACTTAGTGCCTCTCGTATCCCAGCATCCGTGAACATCCTGCCAGCGCAGCTGCTGACCTACTCGC
TTTCAAAGGCCCACTCCGGCCTTGGCCTGTCGGACGCGTGGATTCAGAAGCTGGAAGCGTGCTACGAGGACAAGCGTCAAGTGCTAGGAATCAAGCGGTG
TGCTGCCGGAACAGACTGCGCTACGAAGTTTGAGAGTGGTGATTTGCTCCTAGCGATCGATGGCCAAGTGGTAGTGCGTGACGTCGATGTGGAGCGTGCT
GCAGACGGCAAAACGGAGCTAACAGCGCTGGTGGTTCGCAACCAGCAGGAAATGGAGGTGGTAGTGCGCACGTCACAGCTCTCAGCAATGGGCACAGATC
GCGTTATTGTCTGGTGTGGACTCGTTATCCAAAGTCCCCACTATGCTGTTGCAAGTCTGGGGTACATCCCAGAGGAAGGCGGCGGTGTATATTGTTCGCG
ATGGTGCTACGGCTCCCCAGCGCATAAGTATGGTATGCGAGCTACCATTTGGCTCGTTGAAGTGAACGGTGAACCTACACACACACTGGATGCATTTTTG
CGTGTGGTGGAGCGTCTTGGCAATCGAGAATCGGTTCGCTTGAAGACCATCTCTATCAACACCAAACCCAAAGTGTTCACGCTCAAAACGGACTACCACT
ACTGGCCTACAGTTGAGCTACACCGAGACGAGTTGGACTGGAAATATGTGGAGCAT