Description :
From Genome Similarity Track
Location :
Scaffold_44:92005- 93633
Sequence
1628 bases(100 bases per row)
CCCTTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACCACAAACCCGTTCAGCATGAACATGTTGGACGGCAAAGGCGACGACACCTTTTACGGCAC
CCGTGAAAGCTACTCCTATTTGAGTGATGTCGAATGGAGTGCGGTCGAACGAATCAGTTCGACCGTTGGTGAAGAAGCTGTCTGGTCTCTGCTATCCTCA
AGGGATAGGGACCAACAGCATTCCATAATAGCCAAGTTCTTGCAGCGAGAACTTGACGTGTCGCAAGCGGAAGTGATCCTGTTGCATCAGCACGGTCACC
AGCAGACTGAGCTCCTAAGACAGTAACAGTCTCAGTCTGCTCTGCAGCGTCGACCCGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGTAC
CGGGGAGACGAGGAAGACTCCCTGTTGAGATGGTTTCTCAAAGGGGACGATGCCATTTAGGCTCGCCACATCGACGACGAGGACATGCAAGTTGCATTTG
CCAAATAGAATTTGTCAGGGCGTGCCAGATCTTGGGCCCTGAATCTTCAATTTCACGATTCAAACGTATTTGGATCATTGAAGGTCTTTAAGACTCTGCT
CAGCCAAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTAACAGAGCTCCTGAAGATAAAACAAAGTAAGCGTGACGTTCACGCTTACGCTCAGCAC
GTTCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATAGATGATCCCGTGAGGCACC
ACCTATTTCGCATCGAGTTGAAGTCGCTTGAAGAAGCGATTACAACTGCGGTGCAAGAATACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCCCTT
TCTTCCTTCGAGACGAGTAGATGGGGGAGGTCCAGAACCAATGGACCTCTGCAGCGTTGAGAGCGAGAGACCTCGCTCTTCAAGCATTATGCGATTGCAA
AAGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGGTTCACGCCCAGTGTCTCGAAACACTGAGCGAAGTGATCGACCGTCTGCCA
AGAAGGGCAACGGACGCGGGTCCGACGCTGTTGCAAAGTCACAACAGTGTAGAGGGCCGTCAAAAAAGGTCGGGGTCAGTGGGGGCGGGCGCCCTACTGA
TTCAGCAACCTCAATAGAATTTGCAAATCTATCAATGAAAGTTGCTCCAGACTCACATCCTTGTGTGTCTCTGCAATTGGTGATGAGGTACCCCTCATCA
CCTTGAATTTAGAAGTGACAAAAGGTTTGTCACTTCGTGCGTTAGTTGACTATGGGGCGTCGAACAACTGTGTTTGTCACCAGTCGCTAGAGAATCGTAG
GCTCAAGTTTGAGGGGCGCGTTACTTCTTTTACGAGGCTGACGGTGCGCTTCGCGACAGGCGCATCTATAGCAGTGATGAAACGTGTAGTGGGATTTCAC
TACACGTTAGAAGATTTGCAGTACAATGATGATTTCATCGTACTTGATTTAGATGAAAAATTTGATGTCATCCTAGGGTTACCCTGGCTCAGAAGGTACG
AGCCAAGGGTCAGCTGGCAGCATCGAAC