Description :
From Genome Similarity Track
Location :
Scaffold_47:920- 7407
Transcript NameFunction/comments
Physo_117884putative DNA helicase homolog

Sequence
6487 bases(100 bases per row)
TAATAGACATACAATATAAACCAATCATTTTAATACCGATTATAGGGCAATGGGCCGCCTTCGCTACGCTCGGCAGCAACAAATTGTTTTTGCCATTTCT
GGGGGCCTTTCTGGGGGCCGCCTCGGCAGCTAATCGTACTCAGTGTAATTCGTACTTAGTGGATAAGCTTGACGATTTCTGTGACCGACGGACAGCGCGT
TGCTCCAATTGATGTTTAGGACTAGCCGAGCGCCGCCGCTACGCGGCGGAAGGTTTTGTGGTTAGCCGTAGTAGTTAGGACCGCCCACCTTCGCTTCGCT
CCGGTGGGCTAATTAGTCCGGCGTGTTTGTGTAAAACTTGTCAAAAAAACCAAATTCAAATGCAAAAGAACACGTATTATTCAAAGTTATGTGCAGGACC
CCTCCTCGCCGTGACTACGCCGTCTCGAAAATTTGTCTGTACACGATGTTCGCTGTGTACGCTCCATCGTCTTCTTCTAACTGGGGGTATTCAATCAACG
CCTTGATCTTGGATCGGGCGGTAACCCGGGAGAGCGCGACATACAGCTGGCCGTGTGAGAAGCAGGGAGACGCGAGGTACAATCCGAGGTTAAACACCGT
TTGTCCTTGGGCCTTGTTGATGGTCATCGCGAACGCGGGCTGTACCGGGAACTGCTTACGCCTCAAGCGAAACGGGAAGTCTCGAGCGTTGTCGTCACTG
ATGAATACAATCCTGGGAATCAACACGTTTTTTCCGCGGCGCTCCCCCGTCATGATCTTCGCGTGGATGACATGAGGTTTTAGCTTCACACCCGCTCGCG
TGCCGTTGAATAGGCCTAAGTCCGGGTTCAGATTTCGCATGAGCATGATTGGTGCTCCCACCTTAAGCGTCAGTCGGTGGGGTGGGATACCGTTAATGTT
CACAGAATTCAGGACTTCTTGGTCGAAGAAGTTGCTGCCTTGGTCGTCTTGTACTAAGTCAATAGAGAGATACTCTTGGGCGTCACCCTCCAGGCGCGCA
GACACCACATCGTTAATACGTTGAGCCATAGCATTAGTCGTCGTCAAGATAGTACGGCTTGCGAAGTAGTCATCAGTTGCAATTGCCGGGTTGTTGATAT
CCGCATACATGGCATCAACCATCCGAGTTAGGCCAATTGGGATAGCCCCTGGCATGATCTCAGCATCCTCGTCTGGTTCTTCAGGCGGGTTCTCAACCAA
CATGTCCCGCGGGATCTTCATATAGTCGCCTCCAAGGGTAGGGTTCACCTCGTGTCTGCCTTCACCAACTTGTAGAAGGAACTCGGAAAAGGCTGCCAGC
TCAGTCGATGTGCTTGCGCTGTGGGTCGACCGCACTCGCATGTTCTCGGTGAGGTGGACTTGTTCGAAGTGCTGCCATAGGCTGGACGACTTCAGACAGG
CGTCGATCGTTTCGGCAGGCGTGCCTCTCACTACCACGGGCAGAATTTACCGAAAATCACCCGACAGTACGAACGTTTTCCTGCCAAACGGTTCTTGATC
GTTTTCCATGATATCTCGTAGACTACGGTCGACAGCTTCAAAGGCATGGCGGTGGGTCATTGGCGCCTCGTCCCAGATGATCAGACTGGCCTCTTGAATT
AACTTCCGGAGTTTGGACTGCTTGTAAATCGAGCAAGTCGAGTATTCATTCAGCTTGAGAGGAATCTTGAACGTAGAGTGTGCGGTGCGCCCACCCATCA
GCAGTAAAGCCGCAATCCCGCTAGACGCCACCGCAAGTGCGAACTTTCCCGAAAGGCGGACACTTGCCAGGATATGCTTGAGTAGTGTTGATTTTCCCGT
ACCACCTGGTCCGTCGATAAAGAACAGTTTTTTGCCAACTTGAGGATATTCCACTGCATCCATAACCTTTTCGTAGATGGCGCGTTGACCTTCGTTCAGG
TCACCGGTACGCTCGTGAATTCGGAGTAACACATCCGGCTTGTAACCTGTCCGTTCCCGGCGGATAAGGTTGTTTTCCAACAGAGATTCCAGAACCAAAA
CCCGATGCTCGCTCAACTGCGGGAGATCAAAGTCATGCACGGCATACCCGCTTACTTGCAAGTGGTCGTTAAGTCTCTTGAGCGTGTGGAATTGGACAGT
ATCCGCCTTTGTCTGACCTTCAAGATTCTTGTACTTCTTCTCGATATCACTGGAAAGTTCTTCGTAGAACTGATCCCACAACGCCCGAACGTCTGTAACA
TGGGAATACACCAGCAACGTTGCGAACAGCTGGCGCAGTTGCTTCGGCATCTTAAACGTTGCGGCCTCCGACATGCATGCGACACACTCTTGATCGCCGT
CCAGAAAACCGGCGTGCTTCGCCACCAAATGATACGTGCTGTAAAGGACTCTATTCACAGTGCGGGCATCCTCGAAGGAAGTCGGTCCCCTGTGGTGACA
TAGTAACACGCGCAGATAGAAGCGCTCCATATCTCTGTGTGAAACGTGGATCAAGCGTCCAATCACCGCCTGGTAGTTAGTTCTACGAACCCACTTTTTC
GCCTTGTCATCCCAGGAAAATTTCTTCGGGATATCTTGGTACAACATGGTCTTGGCAATCTGGTTGCATTGGTACATAGCTCGAAAAAGCTCGTCAATAT
TGTACGTTTCCCCCGATCTGCGACCGCTGCTGGGTCCTCGGTGGGTTGAAAAATCACCGTCTGACCATCTTCTAAGTGAACGGTAAGCTTCGTAAAGGAG
TGTGTCTTGCCTTGGATATCGTACGCCAAAAGCCGCATACATGCCTCTACCGATGATATGTGTCTGGCGTTCAAAAACGGTAGGATCTGGTTGGGCTCCA
CACGGGGGCTGTTGGGGTCTCGCACGGCTTCAATAGTAATCACAGCTCTGTCGGACCCTTTGTATACGTACTTGTACAGATACTTCACCGCCGTAATTGC
CGTACACACCTCCACGTTGATGTGGCAATTGTACTTTTGCGATAGGTACGGGTTGTACGGAACCACCCACTGGTTCACTGTCTCGTTGTCGTACGTCTTG
CCTTTGTACGTTAGAACCCCCGGTTCACGCCGGCGCCGCCTGTACACAGGATATCCATCTTGGTTCGCTCGAGTCACTTCTACCAACGGCTTCGGGTACC
CCTTGGTGCACTTCCCCTCCTTCATGCACGGGCTCGTAGGGTTCGCAGCTCCGCACGGACCATGCATCATGCAACTCATGATCGTTTCGTACAGATCGGG
ATTAACGTCCTTGTTGGGCACCTCCGCAGACACCAACTTGTCAATAATCTCGCGAGTCCGAGGCTTGTCTCCATCCTCCAGAATCGTGAGAATGTGGGCG
TGTGGAAGGCCGCGCTTCTGGAATTCTACTACGTAAATACGGGCCTGTAGTCGCCCGATAATACCTTCGTCCAAATCCGCCAGAAGGGTCTTGAGCTTTT
GTTGCCAGACCCGGGCAACGATATCCGGGTGGTCTTGAGCGGTTTGACCCGCAGGGAGCTTTTCCAGGATCTCTTCCCACTTGGGGTTGCAAGTCTTGGT
AAGGAACACATCAGGCTTCCCGTATTCACGTACAATAGCCATTGAGACTTGATACGCCTTATACATGTAGCGCGGGCCACCGACATGCGAGTCCGGAAGG
ATAACTCGTTTGCCGATTTGGCCCAGAAAGTGCTCGTCATCGCCGCTGCGTCTCCGATCTGGGTGTACCAATTCGCCGGTTTCACGATCGAACTCGGACA
CAACTGCTTCACCTTCATCTGGCGTCACAGTCGTCTAATTGAGCAGCGCGTCTTGAACTCCGTGATACTGGTCCGCACGGATCTCCTTCTGATGAGTAGC
CACCCATCGCAACTGTTCGTGTTCACGCTTAGCTCGCTGGTCGACCACCCATTGCTGGCACAGCCGCTCACCTTGGAAAAGAGTCGATTGATCCCAATCC
TTCTGGAACAGCCGATAAGCGGTGTGTTCGCGCAAAGCCATCTTCCGTTTCTTCCGATACAGAGCTCCGTCCGCGTACAGGTTTGAATACGTCCATCCGA
GGTCGCCGTAAGGAAACTGCAGAGGATATTGAAGAGGATCGTACTTCTCGTCGGTCTCAAATAGACGCAACAGTTGATGGTCCCGCGCGTAGAGAAGCAG
ATCGCGTGGCTTGGGAACGTTACCATCCGTGACCACAACGGCGCCGACTTCAGAAACAGTAGGCGAGTTGTGCGTCCCGGGTTGGGATGGCTTAGCATGG
AGCTTGTACTCAATGTCCATGATGGGTATACCCTTCGCCAAATCCGCTCGCAGCTTCTCCCCGAAGTTTAGGAAATGCTGTGCAAACGGATTACACCGCT
TCATGATATCCTCGATATCCTTCAAAGCCACGTTGTCCAGATCAGCATAAATACTTTTGCGTCGCTTGGCACGCTCTTGCATAACCGGATCCACGATGTA
GACCTGTGCGAACTTGGGCGCCGTTCTCTCGCCTGTAGCGCGGTCCACGTAAGGCAGCATAGATCCCAGGTAATGGTCCATTGCTCCTTGGATACGATAC
GTGTACACGCCGTTTTGTCCCGCAACCTCGTCGTCTTGAGCTACCCCTTGAAATCGTCTGTCGCTGGAGGAAGCACCGATTGACGTAAAAGCAATGGCCT
GGTTGTACGCCCGGATATTGCGGCGGAACTTGTCGTCTCTATACCCCTCCAAGAGCCGCGGAGGTGCTGCACGAAGCGGAGGTAGTTTCACCCTGCCCCG
CATGCAGCAAATGAATTCGAACTCGCCCGGCCATTTCCAAGCGTGGCACAACCGGCCCATGGTTGTGGGAGGTAGTTTGTGGCGCCCGTTGACGATGTGT
TGTCCCCTAACGTTGGCAACCCGAAAGGTTTCATGGTTGGCGTGTGCGTGGCGATGCTTAACAGCCCTGCGCCGAATGCGGTTCTGTTCACGCAGTGCCT
CGAGTTCTGTTTCCGTTAGGGCTTCGCGCCTGGTAGCGTATTGTTCCCGGTCGACCGCTTGTGACCTTTCTCGCTCCTCCTGGATCTGTGATGCACGCCT
GACGGCATGGCGTTCACGATCACTTGCTTGCGAAGCCGCACGCTGCTCAACGGTCTGTTGTGCGCGTCTCGCAGCTTCTCGCTCTCGGTTTAGCTGCCGA
GCCGCCTCGCGTGCATCCGCAGATTGCCCTTCGCGATGGGTTCGCAAAGAAGAGCGATTGCGATCACGCGCCTCATCCCGATTCGCAGGGTTTTGACGTG
CACGTCTTGCCTGTTTACGGAGTCGATCAGCTTCCCTTGCTGCAGCTCGTTGGGAATCCGTCCTATTAGCCCTTGAGGCTCGCGCGCGTTCTCGGGTTTT
AGCCTTGGTACGCTCCTTTTGCGATGCGGTCATGTTAGCTTGGCGAATCCTTTGACGTTCCGCGTTGCGGGCTCGATCGGCTACCGCTCTATCGGCTGAG
GAGGGGATCGGCGGTGATCCCTGTACAGCCTCTTCTTCCGCAATGCGATGTCCCACTGCGTATGCAGTCGCAAACTGTCGCTGGTTCTCCAGCGGGTCAT
CCTCTTCCGTCTTGCCTTCCTGCTCCACTGTAGGTTGTTCAACAACCACGTCGACCGGAGGCGCAGGCGGCGGTGCACCGCTGCCATCTCCAGCAATACT
GAGAGCTTCCAACTCCTTTTCCAAGCCGCGTTTCACCCGAGAGCGTGTTTTCTGGCGCTTCCGCTTTACTCCCTCCTCCTCTGGCTCTACCGGTGTCTTG
TTCACATGCGCATATGTGCTTCAGGGCCGCTCAGATTTCAGCTCGAGTGCGTTGACGTTTGGGGCGGCGGGCCATGGCTCACTCACTGCGAACACGAAAC
AGAGTAGCGTGACGCGTTAGACATAAAGTCTAAGTACACCGCACATAGCAGTAGTCTTCCATGCTGCTTGGTTGTGTTGGACATCTGCGTACTGCCCGGG
TGGTGCGGCTCCCATCGAAGTTTACTATCTCATGGAACGAAGTAACCGACACGAAACACCGAAGTGAATTCGCTCGCAAACGTGCAGTCGGCAAGTCAGG
GTTGAGCGCCTGGGCAGTACTGAGGGTCTTCGTGCGATATCCTTTTGCGCATTCATGGGAATGGCTTGGTCGCATGGGCCAAAGGACCCATTACGGCCAG
ATCAACTGGTTCGCGTTCGGGTTTGTTGTCAATAGACCGGTGCCAATATAAATTACCAAAATGTGTCAGATTTCGATAATCTACGTTATGCTACTCGCCA
GAGTGGGCGGTGGGTTTAAATACTCTGTAAAGGTCAAAAATGTGTACGACTATAAATAGTCCTACCCAAATTAGACCAATATTTTTAAAAAAAAACCTAA
GCACGGCTTCCGCCTAGCGAGGCAAGCCCCGCTAGGATGATACTTCCCCCTAAGCAGCACCAGGAGCCTCGGACTATCTGTGCGTGGTGGTGGTGGTGGC
TTGTGAGGCTAACTAACATGCATACACGCAGCGTACCTCGTCGGCGTCGTGGCGCGCGCGAGTCCCAAATTCAAACTGGGGGCAAAA