Description :
From Genome Similarity Track
Location :
Scaffold_1666:920- 6149
Transcript NameFunction/comments
Phyag_g11224protein kinase, putative
Phyag_g11225hypothetical protein PHYSODRAFT_472892

Sequence
5229 bases(100 bases per row)
CGATGCCCGCGGTCGACGAACCCTCGCGCCGCGCGCCGCCGGACGCACCGTCCCGCTCCCGCTCCGcagccggcagcagcagcagcagcctcagcgccac
gttccagCACCAGGTCCAAGTCGCGAGCAATCCCAACCTCCGCGCGTCGTACCAGGACCCGCAGacgcacaagaagaagacgcggcacagcaacagcaac
ggcaacagcaaaaaacaGCTGCGGCACTCGCTCACGCACGTGCAGGGGCGTGACGCGCCTCCGTCCGGCCGCTCCAgtgcgtcctccacgtccaaTTCGG
CCCATTCGCCTCCTGGAAGGAGCTCCAACTACCTCAACATCCACACCACTGGGCGAGATCTGagtccgcagcagcagcagcacccggAGTATCCGTCGGT
ACCCTCCGAGGGTGACGATATCCTGAAAGTTGAAATTCCACGATGGAAATCCAAACTCACGACGGACCGAGCAGACCGCGTGCACATCCCTGCAGGAGCT
GACAGTGCTGGAAATTCCCCTGTGGCTAGtggagctggaagatcgTCCACGTGGAACGGGAAagatggacgaggaggacatggaggCTCGATGGGGGCTT
TGGTACTGGGACGAGATCGGGATTCGGGCAGCAAGAAACGCTATACAGTGTTCCAAGTGTACGTGCACTTCCAGTCGGGAGCTATTCGGGTCTCGGAGAA
ACGATACAGCCACTttcgagagctgcacaaGACGCTGAGGAGGAAATACGCTACCGTGGGGAAGTTGTACTTCCCTCCGAAGAAATTCTTcatgtcgttg
tcgttgaggGTCATTGAGCAACGCCGAGAGGCTATTGAGACGTACATGAATGCGGTGTTGACGTTGAGGCCAAGGCCTATTGAGGTTGTGCAGTTTCTGA
GTATTGGAAGCAGCTCggtggatgatgaagaagaagatggaaaCAGCACGGACGGACCGGCGCGTGGTGTGGATATGGTCACGGCGCCCAAACAGGTGCA
ATCTACGTCGACAGCGCTTGGGACGTCGTCTCGACACAGTGCAAGCAACAGTTTTGCGTCGGAGGATGCTGGAGGACACTTGGTGACCATGCAGGACTTT
GAGATCCTCAAAATGCTCGGAAAGGGGTCCTTTGGAAAAGTTTACATGGCCAGAGAGCGTGGAACGGATGGCAAGATCTACgcgatgaaggtgctgcgaA
AGTCGGAGCTGGTGAAACGCAATCAGGTGGGGCATACTATGATGGAGCGCCGCATCATGAGCTCTATTGATCACCCGTTCATCGTCGGACTCAAGTACTC
GTTCCAAACGGCCAGCAAGCTCGTGATGGTGTCGGACtattgctgcggtggcgaAATCTTCTTTCATTTGAAGAAATTCCGCTCCTTTTCGGAGGCTATG
GTGCGCTTTTACGCTGCAGAGTTAGTGGCAGCCATTGGCCACTTGCACGAGAGGGATATCATCTACCGGGACCTCAAACCTGAGAACATTCTTCTAGACG
AGACGGGACACGTACGCCTCACCGACTTTGGTCTCTCCAAAACGGATTGCACCGATTTTTCAGGTGCTAGGACTTTTTGCGGCACGCCCGAGTATTTGGC
ACCAGAAATGCTCATCagccgcaagaagaagacggagtACGGCAAAGCTATCGACTGGTGGAGTCTCGGTACGCTCATGTACGAAATGCTCACGGGATGG
CCGCCTTTCTTCGACCGCAACATCGAACAGATGTGCACCAAGATCATGAAGTCCCCGCTGAAGTTCCCCGCGCATTTTGGCCTGAGCTCAGAAGTCAAGA
GTCTCATttcagcactgctggagcgTGATCCGACGTACCGAATCGGGTCGCGTCCTGGTGCAGGCGTAGAGGACATCAAGAAccacgtcttcttcgccag
catcgactggaagctgctggagcaacgTGGCATCAAGCCGCCTTTCAAGCCACGTGTGCGCAGCCCGACAGATATCCAGAACTTTGACCGCGAGTTCACG
AAGGAGCTGCCTGACCATGGTTTCTTGCAACAGGACAAGCGTCTCGCCATGTCGCCCAAGAACGAGTTCCAAGGGTTTTCCTACACACGGACGGAGGAGC
CAGCATCATCGTCTCGCGAgtcaacaagcagcaaacgGGAGAAGCGACGTTCAGGGCGCCGGTCGGAGCCACGGATTAGCGAAGGGTACGTACGAGGAAG
ACATTGAAGCAGCGATGGACGTCAATAAGGTCTACTGGGTCTTCGTAGGGGTGGCTGATATTTGCCTCTGCTCTCTTGCGTCTTGGTTGGGCCTGGGTGT
TGTTGCTAGATTTGAGCGCGGGTCCCAATCAGCGGCAGATCAGCACTATCCTGAATTCGGCCTTGTTGCCCGCGACAGCACGGATTTCGACACTGGTTGC
ATCTAGAGCGCCCGGAAGTTCGGCCAGCTGCCGGCCACACCGCGCGCTCGTTATGTCCAgtacaagaaggaggaagcagGTGGGAACCGCCATCGAGTAC
ATGCGATGATATTTTGTCTCTAATTTAGACTTGATGCAGGTATGGAGCCGATCCGAGTCGAGTTGTTCGCTAGGTGACGCGAAATACGTTGTAAGAAAAT
GAATGAACCTAAAAGATTACATGAGATAGCACACCAGCACTCCAGTCACacacaactgcagcttcagtcATGTtggttgcagcaattgccaCAAGGCGCT
TGCTGCCGATCGTATCCATAGAAAACCGGTAGCATCTTGCGCATGGTGTGCAGAGTTTTATGGTCCTTGAAATTGTACACGCGCTGCCATTTACCGTCGA
CGTTGGCATAGCGGTGCGAGATCTCGCAAGATTGCGCTGCTTTTCATGACCAAGAACAGCACAGGCAAGAAATTAGTACATCGAATCAGGTACAAAGATC
AAAAGGTACCATGCAGGACGTTGCTCACCATTGCACGCAGCGCATAAGTCGTAATCACTACAGACAGCGCAGTTAAACCGCGCGCCAGTGAAGTCTGTTT
CGCCGCACGAATCACAGATAAACCCCAGGTGACGGCCCTCCATAATAAAGCGCAATGTAGCAACCGCGTCCTCATGGCATTTTCGAAATGCACTTCGCAC
GCGGAACTTCGGGATGTCCAACTTCTCGGCTAAGTTTTCAACTTGTTCTAGCGTGGGTGGCACCAATCCATTCGGGTTGAAGAACTCACGCGCTTCCGCA
TAACGCTCGAGCAACAGGGAGTGCATCGGATCTAGCGCACTCGTCCGTGAAAGCCCATTGAGACCTTGCGGTCGCGCGCAAAATATCACAATATCTGCTG
GCTGCagtcctgcagcttgagccGATGTATTGTACGGGATGTATTCGGAAAGAATCGTGGGGGCAATCTCCTCTCGATACATTTCCAGCtgcgtgcagct
ccacccTGTATGGCGTGCGACCGCCTCGTACAAATCACTAGGTGCAAGTATTCCACTTTCAGACTTGTCCGTGCTTTCTGGTGATGATGATTTCAGAACA
CGAACTTTGCCAACGTGCTCGAGGCGATTTACAGGGTCCGGTTGTAGCAGCTTCACAAAAACATACCCGTCTGGAGTCGCCAACGAATCCTTCGCAATCG
CCTCATCATCAGATGGTAGATCCAGTGGAATATCGTTCGTCGAGAGGCTATTTTCGACGTAAATCTGGCAGAACGAGTAGGCATCGATGTCCACTCCGTC
ACAAAGCAAATGTCCGAAAAGCGGTCGATCTTGCAAAGATTTGTCGCACGCGAGCAATTTACGTGGCCGAAGTGCTTGACCAGAGACCACAGGCTGATTG
AAGCACCATATTCGTGTCCTGTCCACCgtttctccatcgtcttcttctctaaATTCCCCGAGCACTTCGGGAAACTGGTCATGCAATGCAACAAGCAAAT
CACGTAGCGAACAGCAGAAAGGAAGCTCCAACTCCGCCACGTTAGAGAAATCGACGAGTCCCAGTTGATGGTGTTCTCGAAGATCGTGTTCGAATACAAC
ACGAAACGTAATTGACATCAGCCGCACCTGCACCGACACAGTGAGTGTATCAGGCTGCGTTTGACCCTCACCAGAGCTAGTAAGGAAGCCTTGCTGAGGG
TCACGAAGCATATTTAACGAACCGAGGGAGTGCACTCCCCAATTATTGAGATGTTTGTGAAACTTGTTGTCCGTCAAACACGAATGCCACTCAAGCCGGC
GTCTCGGATCCAGTGCattctccacctgcagcgagAAAACTGCACACGTGAGCCAATCCGGAGGTCGCCGGGATAGATCCGTGAGCACGAGGTACACACT
AAGTACACGGCCTTTGTACTGTGCCTCATTTGGGTTTCCATTGGGGAAAACCCAGAGGCAAAAACGATGTGCTCCAATAGTAAAAGTGTCCGACACGACT
TTATCCACGTCTGCCATGGCTTCTCCATCAGAAAACTTGTGCACGTTTACCGAAATCTCAGCCCGTCGATCCTTGGCATGTTTCTCCACgtagcagcgtc
tccagcagcctcCATACAACCTCACCACCtaaacacacacacaaaatCCACAATAACTCAGCTTCTAGACCTCCTCTTGCCCCCGTTAAACTCTCATTCA
ATCTTACGTCATAGTCCGGTGCTCCCGGCAAttgtggcagcagctgcatccTCAGCGTGGGCCATTGGTTGACACAAAGTCTCTTCCACACTTCTCGATC
GAATGTGAGGCTTCTGAAGGTCCTACACGTCGCAGCACACGCCAAGAGCGAGTGTCCGTCCAGCTGCGCCAgagccaacgccagcagctcgtccggcAGC
GTCTGGATGTCGCTTGGGggctcctccttctcgtccgcagccatctccacgtcctccgaGTCCAAACTCTCGCAGTCCGTCTCCCCTGACGAGCCCTCAC
TGGCGCGGCACTGGGACAGACGCgggtgctgcttgacgcgtctgttgctgctgttgcctGCAGGACTGAGCCActgccgcttcttcttggggctTCGAGA
ACGAGCCGACGCGACCATTTGCCGTTAGTAGAACGAacgaaagaaaaaaaaactgaTAAATAAGGTTTATGGATCTTTAGATAAATCTaaagagaaggag
cagcgAACTTCAACTTTTCTTTTTTTGGACAGCACTTCTATGTGCAATGTGTATTTACTCGAGAGGTCGGATACTTTATCGATACTTGAGTGGTTATTTG
AAAAAGATGGCGTTGAACAGGAACTTccg