Description :
From Genome Similarity Track
Location :
Scaffold_2813:920- 2470
Transcript NameFunction/comments
Phypl_g15410hypothetical protein PHYSODRAFT_336537
Phypl_g15411hypothetical protein

Sequence
1550 bases(100 bases per row)
CCGTCTCATCCGTGTTGAAGatgtccttggcctcgtAGAGATCGGTTAGCTCCTGTAGTTGCTGTCGGCCGAGCGCAACTACTGCTGGATCACCTGAACC
AGCTTCACCAGGCCGCTCACGGTAGCGCAGCGCATGCCTCCGCTCAAAAGCAGTTAGTCACCCGTCTGAAAAGGAGAGCTCCCAAGCGTCACATAGCTCC
CTCTGTATATCACGTGCCTTCACCATGATCCATTCACGAGAGAGACATATGCCCTGGGACTCCAGATTCTGTATCCACGCCCAAAGCGTGTTCTCCAGGG
CTAAATACGTCACGTTCAGGGGCTTGCGCCTGATTCCGTCGCCGtagtcgtcgctcatgatCTTGGGGGCTCCCTTGAGGATGTCTGAGACGGTCGTCTG
AGCAGGGGCATGCTTGATCTTGAAGGTCACCTTCGCCCACGCCGCTAACTCTTGCTGCGTCATGGCTGGACAATCGGCTGCTTTCTCGATGAGAGCCCTC
TTCTGCTTGATTTTCATCCAGCCTCCCATGGTCTGTTGGTGCTCCGATTGAGTTCTGGTGCGTGGCGAGCGGCTAGGTTGCTCCGCCGCTCTGCTGAAGT
GCCAATGGCTGGTGCGTATGCTTCGCAATGGCTGGTGTGTAGTGCTTCGCGCCAAAAGTCCCGCCAAAACCATAGAGCCTTTTCACCTTTCTAAAGCGAT
ATTATCATTCCGTTCAGGGTATTCATTTGTAGCAGTACCGGAATCGAGCGCACTTACTGTAATTGGCAGACTCCGAACCGGAATCCGGACGCCACCATAC
GTTTTGACTGGAACACATGATGAAAAAAGGCGCCCCATCCAAATTCATTATTCATTCCGGACATCAGTGAAATTCGTATTTTATCTAATCTAGCGACTAG
TGGTAGGACAGCGGCGCTGTGGGCAGCGGCATAAcggacggcggcaccacgggCGGTAGCACGACTGACGGCGGCATGGCGGACAGCGGCACCAAGGATG
ACGGCATGAggggcagcggcagccacTGGCAGCGGGGGAGGGGCAtgagcagcggcatgacGCACGACTGGACAacgtacagcagcacgactGACAACGT
CATGAGAGGCAGCGGCAGTCACTGGCAGTGGGGGATggcacgacgagcagctttATGATGGACGGCGGCATGACTGACGGCATGACGGACTGCCACTTAC
ACGACGGGCAGCGGCATCACAAACGACGGCACCATGGGCAGCGGGGTGAGGCACGACGAGCAGTGGCATCACGGACAACGGCGCTACGGGCAGTGGCACA
ACGGCTGCGGAGCGGCGTGGCGGGAGTTCGCCACCGCCCCGTAGAAGAgtcgcccgccgccgacttCCAGGCCAAGATCCTCATGGAGATCCCCGCCCAT
ATCCGGTACGTTAATAACAGGATGAAGCCAAAGTAATGAAAATTGGAGGCACTGACGGTGTGTTGTTTGTGGTGTTTGACAGTCGAAGTCTGCTGCCGAC
ACTGTGACGAGCATTGGTCTGAGCTACGCGGATGTGAGCATGCTCCGTGC