Description :
From Genome Similarity Track
Location :
Scaffold_3256:920- 1933
Transcript NameFunction/comments
Phypl_g15722hypothetical protein PHYSODRAFT_332751

Sequence
1013 bases(100 bases per row)
CCGATGATTCTTGGTCCAATTGTTCTTTCTTCACTTGCGCATCTTCTTCTACGAACTCACGGTGAATTCCTGAGTCGCCAAGAGATCCGGGCAGCACGGC
GTGCACGAGAGAAAGCCCAGGTAGAGTTCGAGCAGCGCTGACAGCGACTCCAAGCTAGCGTCGAAGCGGACAAGCTTACGTGGGCTACGGACCTTCAACA
GAGCCTGAATGCACAACTGGGAtccttccagcagaagattCGGTCCCTGGAGGATGCACGCAATCAGGACAAAACGACTATCCGGAATCTCCGGAATGTT
CAAGGAACGAACTCGCTCGTGCAACATTCCTGCAACATAGTCCCAAGTTCAAGGTGCTCAGGGGTCGCCTGACCCTAATCCAGCAACTCAACCCAGGTCG
AATCCGGATCAAGCAACTTGAAGCCGAAAATCCAGTGGCGTAATCACTGGAAACGCAAGTGATAGACGGGCCAGATCAGCTGTCCAGATGGTCAGCAGTC
TTCCTGCAGCCCAACTGCAAGTGACCCTCCAAGACTTCACTGAAAGTAATTATGTGAAGGAAGAAGCGACAGCTGGGGGGAAAGAGTCGGCGCCCAGGAC
ATCCAAGTCGAGTGTATCCCGAGGATCGGCGCCGAAGCCTAAAGCAAAGTTGAGTGACCGCCAGACGCGCGAAGACAAGGAACTCCCTCGACGTGAGTCT
CACAAGAAGCACTCGCGCGGACATGGGGCCCTTCAGACGCAGGCTCCGACCCGGAACCTAGCGATGGAAGCTCTAGCGATGGAGACTCCGACAGCTTGCC
CGATGATGTCCCAGCGAACCAAGCGACGACCACTACACAAGGCGGCACCACCGTGATGACATTCCGGCCGTACGTGAACTCAAGTACGCTGGAAGACTTC
AACGACaaggcctcgctcgctgcgcgtcgtcgctggtgggAACGCTTCCTGAATATGGCTGCACAGGGTGGTTGGACCAACCAGATGAAGGcgtacgagc
tcaagctcacAGT