Description :
From Genome Similarity Track
Location :
Scaffold_1565:92- 2484
Sequence
2392 bases(100 bases per row)
GACGATGCCATAAGGCTCGCCACATCGAAGACAAAGAAATGCAAGTTGCATTGCCAAATCGAATTTGTCAGGGCGTGCCAGAACTTGGGTCTGAATTTTC
AATTACACGATCCAAACGTGTTTGGATCGTTGGCGGTCTTTAAGACTCTGCTCAGCCAAACGTTCGAGCCGCCAAGAGCTGAAGTCAGGACTCTTCCAGA
GCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGCACGTTCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTG
GTGTTGATCACGATATTCTTACAGGGCCTCATAGATGGTACCGTGAGGAATCACCTATTCCGCATTGAGTTGACGTTGCTCGAGGAAGCGATCACAACTG
CGGTGCAAGAGGACTTTAGTGTGAGACAAGCTCACACTAGCTTGACCCCTATCGTCCTTCAAGACGAGTAGTGGCGGGAGGTCCAGAACCCATTGACCTC
TGCAGTGTCGAGAGCGAGAGACCTCGTTCTTCAAGCAGTAAGCAATTGCATAAGTGCAATCGCTGTCAGAAGTTAGGACACCTACAAGTGTAGTGCTTCA
CGCCCAGTGTATCGTAACACTGAGCGAAGTGATCGACCGTTTGCCAAGAAGGGCAACGGACGCGGGCCCGACGCTATTGCGAAGTCACAACAGCGTAGCG
GACCGTCAAAAAACGGTCGGGGTCAGTAGGGGCAGAGTGCCCTACTGATCCAGCAACCTCAATCGAATTTGCAGATTTATGATGAAAGTTGCTCCAGACT
CACAATCCTTGTATGTCTCTGCACTTGGTGATGAGGTACCCCTCATCACCTTGAATTTAGAAGCGACAAAAGACTTGTCACTTCGTGCCTTAGTTGACTG
TGTGGAGTCGAATAACTTTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGCTCAAGTTCGTTGAGACATTACTCTTCCTACGAGGCTGACGGTGCGCCTCG
TAACACGCACATCGATAGCAGTGATGAAACGTGCAGTGGGATTTCACTACACGTTCGAAGATTTACAGTACAATGATGATTTCATTGTACTTGATTTGGA
TGACAATTTTGATGTCATCCTAGAGTTACCCTGGCTCAAAATGTACGAGCCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATTCCCGTCACTTGCTCA
TCAGATGGCCATCTGATGAGCGTCTTGGAGTGTCCACAAGCGTGTGGATGTACTGGGACTGAGTGCGCTGGCCTCACTTGCGGTACGGTCATTAGTACGG
CTGCACAAGATCACAGTGTGACAACCAATCACACTGTGGAGGCAGCTTATGGAGGCTGTGCGGATGCACAGGCAGAGCCGAAGGTCCATTACTCGAACAA
TTCGAGTGGATCGGGACATGGGTAGACGCCTAGCGGGCGACATCCAAGTAAGGGTAAACCAGTTGCCTACACACGGTAGCACGATTATCCTAGATCGACT
GGAGAGTCGATCGTAGAGGACCTAGCTGTGGTAGCGCAACCACAGCTAGAAGAAATCGAGGGAATAATCCCCCAGCAGCCTGTGGAAAAGGGTTTCCAGG
AAGAAACCGAGACATAGAATGTCTTGGTTATTGACGGGTCAAGTATAGGCGCTTTTACACTTGATCTGATCGCACCTCCGAATTCGACTTCGGAGATCAC
TCAATTGCCAACGCTGGAAACGAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGATCAAGTAGATCTGTGTACTTGTCACGAAGGACGAGTACGTGACT
GATATTCGGTCGGCAGTATTATTTTCAGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGATGAATGTGTCCTCGATGAGAAGACTCAGATTCAGCGAT
ACACGTCTCAATATTGGGAGTCGCTTCAGGCAAAACCTTTGTATAAGGATTCGATCGAATTCAAGGACGTGTTCTCTGAATCCGTACCATGCGAATTGCC
TAAGAAAAAAGGCACTCGACATGAAATCGAGCTCAAACGGGGCTCGAAGTACTGTATTATAAAGCAGTGGCCACTGGCTCGTGAACAAGTACTTGCGATC
GACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGGCGTCAACTCCCCCTCACAGCTCTCCGACCTTCTGTGTGCCCAAGGCCACAGGAGGAT
AGCGGATAGTTCACGCATTCGACAAGTTGAATGCTGCAACGGTACCGGCTCAGACGCCGATACTGAGGAAGGGAGTAATCATTGATGGTATGTCAAAAAG
TACCATCTTTTTGTCCATGGATCCGATGGATACCTTCTATCAGATCCTAATGCGTGAGCGGGACATCCCATACTCGGCAGTAAGCACCCCGA