Description :
From Genome Similarity Track
Location :
Scaffold_3904:92- 1820
Sequence
1728 bases(100 bases per row)
ATGTTCTCGCTCGGTCCTCATCTTGTTCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGC
CCCGGCTGTGGCTGTTGCTTCCACTGCTGACGAAGTGGATGGGCCGTCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCC
ATCTCCACGTCTCGTGCCCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGA
AGTGTCGCTGCAGGGTACCTGAGGAGGTGTCGGAAGAGCTTGTGGCCGGCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGTCCGATC
TGACGATAACCCCACTGATTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCGCGCTC
ACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACT
CATCCTCAGGGGCGGATTCGTTGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTT
AGCTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCC
GTAAGCAAACGTAAAAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCTCTTGGATCTTCGATCTGTCATGGATTCA
GGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGAACAGCCTGACCTGGATCCAGC
TTTGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTTGGTTTAGG
TACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAG
GGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGATTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCC
ATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTG
GGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTT
ACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATC
TTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGTTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCT
GCGTCCGTGGATGGTTCCGAATCCTAGC