Description :
From Genome Similarity Track
Location :
Scaffold_4169:92- 1442
Sequence
1350 bases(100 bases per row)
GATCTATCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCC
TCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCCAACCATCGCCCGATCT
CCTCATAATGGTCCAGTAATAATCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTC
GCCCCGGGTGACCCACAGTCTTTCATGTTCCGCCCACTTTAACCGGTCTGGCAGCTCCCAATTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTT
ATGATCCTCATCTTCGCTCCATACAACGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATTTAACCTCA
CTCCGGCCGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCTC
CGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGG
TATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGG
GGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGT
GGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTG
AGGAAGACTTCGGATTCGGCCAAACTAATCCCCTGGGCCCAACCTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACGGGATCT
AGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTC
CTACTTTAACATCTTCTCGGCCACTACTGGCAATATCCCTCTGTGCTTGGCAGGATCAAACCATTGGCGCATCGGGTTGTAGAATTCCTCCATCGGACAC
TTGCCGACGTCGTGAATCTCGCCACAACCACGACACACGTAGAAGCAATG