Description :
From Genome Similarity Track
Location :
Scaffold_145:92- 1367
Transcript NameFunction/comments
Phyta_totarag4499hypothetical protein

Sequence
1275 bases(100 bases per row)
CGGCGAGAATCCTCGCGGGAACCAGAGTCCTGACGGTAGTGACGGTCGATAAAGTCTTGTACATCGCGCGGTAGTCGACGGCCCCATGCGTGCGTGCGCG
TGGCATGGGCACACCGATCCGCACTACCGCCGTAGCACATGCCGCCGTTCATGAACCGCAAGCAAGGCTCGCGGCCCTCTGCGTCTCGTGGAATTTGACG
CCGAATATGATCGGGCATAACCGGCACGCGACCGGGATGGGCCCGGCGCGGTGCCAGTGGTGCACTGCGTGCCGATGATAGGCGCGCAAGGCCTACGGAC
GCTGACGTtcgagcagcgagacggAGCGCTAAGCCGTTGAGTGCAGCTTGCCAGTCGGCTGCGTGGTAATCAACAGCCCGCACCGCCTCGCAATAATTGC
GCCACCAGTTGGGTGAGTCCTCCACGAGATGCGCCATCGCCCGGCCCAAAAAGTTGTTCACATAAAGGAGAGTCAATGTGACGCGTTCCTGAGTGTTCGT
ATCCCTCTCCATGTTTGCTAGTACGATGCGTTTGAGCCGGGACGTTAAACGCCGAACATGGTCGTAAACAGCGTGTCGCCAAACGAAGTAAGACCGCTGA
TAGCTGCCAGCAAGTCTCCGTATGTCCCGCACTGCGGCATCGTCGCCGGCAGCATGGCACCAGCCCCAAAATCAAATGAGAAGTTGACGTTCATCGATCC
GCGCCTGAGTTGCTCCATTTCCGTCAACGGCCTGAAGTGCAGGATAGTCAAGCCGCGGTTGTCGAGACGAGCGCTGTACAGAGCCATGAGAACAGGGGGG
TTGCATCGGAGCGGACGCACTCGAGCTCACGTAACTGCAGGACAAAGGACATGGGAGTAGTTTACGCACCTGCCGGAGTGCTCAGTGCTTTGTAGAGCCT
GTGAGCCGCGAGCTGGTGTGCCTGAGGCGGATGATACTCGCCCATTACGCGTGTCCGCGGCGCTGGAAAGCTGGCACACCGCAGGTTCTGAATGGCGAGC
GGAGGCATATCCTCCGCGTTACCGTTCGGAGGGAGGGTCCAACCCGATGCCGCGAAACCAGACCCAccgtgctggacggcatcgcGAGCCATGGCACCGG
TGGTGTCCACGTCCAAACGGTTTACCGTCGTAGCAGCTAGTGGTGGCGCCTGCATCTGCTCTCGGAGCTCGTGAATCATCGCGAAGAGCTGATCCACTTT
GCTCTCCAAGTACGAGCCAGGAGCCGCAGGCAGTGGGCGATGAAATTCCTCCATGAATGCGTCTAGGCTAAACGC