Description :
From Genome Similarity Track
Location :
Scaffold_136:91991- 109519
Sequence
17528 bases(100 bases per row)
TTAAAGATGCGGTCAAAGCTAGAACAGCAGCCAAAAAAGCTAAAAAGTAATCTGCCAGAGAATATAGCATGTATGCTTCGAACCAGGCGCGACTTCGTCA
ATATCGCCATGCGAGAGACGACGAGGAGACAAACAATGAAGCGACGCAGTTTGCATTGTACGATAGCTTAGCAAAAGAAGCTACAGAAGCAGCTCAAGCA
CAGCGACTGGCGAACATGGCTCGTCACATATGGAAACATCTGGCAGCAGCTGATCCTAGTGTCGCCAAAGCAGCAGCGGAGAGCTCAGCTACTCTCGGAA
CAGCTAAGCAACTTGAAGGAGTGATGGGAGAGGTACCTGAGTACGCTGAGCAGTCAAGTGACGTACCGGTGAGCTCTGAAGTCAATGTCACCTCGACTGA
CAATACGCTGGTGCGGCACGAGGCGACCCCCTCCCACCATCGCTATCCGATCCGCCGTCACTGTCGACTTGGATCGCGGATCCCGCAGTGTCGCCTCCGG
ATCCGGCTGTGTCAGCGACTTGTGGAGGCGGGGTCGAGAGGGATCTCCGCCGGGCTTCGGATCGAGATTGGGATAGAGCCCGTCGCGTGTCTTCCTCCAA
GGCATCCTCAGCGGCTCGAGCCTCCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATCGGCTTCTTTCAATTCGTCACCTGGATTGACAATAACGAGTGAATATGGGGTTACT
AGCAAGGACTAAAAGAGGATCCACGTACTCGTGCGGCGAAGCTTGGATTCCAGCTCTGTTTGTGCACGCTTGGCATCCGCCCACTCGGTAGCCGCCTTGT
CCCGCTGGAGTTCGCTGTCCGCCAGTTTCGCTTGGATCTCGTCGCGCAATCGAGTCATACGCACGAATTCTTCGAGCGCGTAATCTCGTCCGGCAGACGC
TTTCTCGAGCGACTCCTTGGTGTCTTGCAATTCCTCAGAGAGTTGCGCCAGGGCTACATCCGGCGATGAGGGAGGTGGATTTGACGCGGGGAACCCTCCA
CGCGCCGACCCTAAGGCGGATCCGCCATGGGTGGATCCCACATAGTCGTTGGTCACCACCTCCTCCTGGGTCAGACGCAACTCGTCACGGAGACGGTCCA
AGTTCGCATCCGCAGCTGCCCCAGCAGTCTGGGAATCCTCCAGATCTCGCTCGAGGTCGTGGATCCGGGATTGGAGTTGGTGGATCTCAGATCCGGCGAG
TGCCATCTCCCTAAGGAGATGGTCGTTGTCATCTCGCATAACGTCTCGTTGACGGAAGGCGCGATCCAGCCGTCCGGTCAGGTCGCGGATCTCGACCGCC
TGATCAGCCAACAGGAGTCGCAGGTCCTGCGACCGAGAGGCCGCACGGTGCTCCCACCCCTGGATCTCCATAGCCTGGTCATGGACTTGGGCCCGCAAGG
TCTGAAGTTGGGTAGTGTGTAGAGACGCAGCTTGGTCTTGGGCATCTTGAGCCGTCTGGGGCGCCGCTGTCAAGGTTTGCACCTGATCGGAAAGAGCCTG
GGCTAGAACCCGCAGATCGGTGGGCGACATAGAAGACGGACTGACCGGAGGAGTGGTGGAGGGGGCCTTGCCCGACGATTTGCCGGTACGCTTGGCGGGA
GACATGTGTCGCGAAGGGGAGAAGCGGTTGTGGATGCTGGTAATGCACGCCGTGAACGCTGTTGTGCAGCGCCGACAACGTACAGGAGGCGATTGTGGTG
AAGTGCTTTCTCAGAAATAAGAGAACGGGCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGCAAGGATTTGGGTTGGTGGCAC
GGATGCAAGTTGCCGGTGGTGGATTAGCCATGACGAGCAACATCCCGTAGGAAATGACGATGGATCTGGTATGAGCGATGTACGAGAAGGCAAGATCCAC
CAAGACTTATCTCGGATCCACCCTTACCTGGATTCACTTAGGTGGATATGGGATATACTATGTACCAGTGGATCGAGTGTGGATCCTATGAAGGAATGGT
GGTAGGTGCCATCCAAAGGTGGATCTAGTAGCCACGGCTAACGAGAAGTCAAGATCCACCGCGAGGTACCCCGGATCTCATACTTCCGAGCTCGGATCCA
TGGAGGGAGGATCCCGCCTTGAGGGACCTGGATCCAGGGTATAGGGACGATGGATGCAGTGGATCTCGAACTTTCGTGGGACAATGGGGATCACAGATGG
TGGCGAGATGAGGTTGGATGATTGGAGAGCTCAGATCCACGACGAGTGTACACTTGCAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCC
ATAATAGGGTGACCGTAATGATTACGCCATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGC
CTGGTAAGGGATTTAGCAAGTGAAAGACATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAGTATCAATACAGACTCCAATTTGCACAGTGACACGCA
AGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAAT
ACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTAGCTCTCAATTCTC
AAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAACGCAAAGGCAAGGGACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCC
CCGGATCCATAAGCTCTAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTGCCACTGCTGCTCCACCCCATCCCCACGTCTCGC
CAGGACACTCAAGCTTCACCACTTGAGCTCTTCGGAAGTTACCGAGAGAGCAAGGTCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGCTCAGCAGA
ACACGGATCATCGGGGGGGCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCA
CATAGGTGTAATATCGATACATTGAATTCCATAATCGTTGATTAAGTAAGCCACTACCTTGCTCTGGATTTAACCCTCCGTCTAGACCCATCTGCACCAC
CTCTGTTTGAAAGCTTTCCCAATCCATTTGAAGCGGGGATTGAAACATCGGGACTCCGCCAACTATGATTTGCAGGCCGGTGAGCGCTGCGAATGGTCCC
GTCCCTGACGGTTCATGCGTCATCACAGAAACCTCAGGAGCGCTTGACAAATTGACCAGAGTACCTGAGCCAGCTGTTGCTCCGTTGCCTGCATCGCCGA
TCAGCATCGGAATGAGTCACTCTCTTGGGGTTGACGATGCCTGGCGAGATTGTGCCTCAGAACGATTGCAATCGATCGATGTAGAAGCTGGTGACGAACC
GCTCGAGATAGCGAATCGACTTGGTCTGAGTCAAAGCTCTGTCTACGTCCGCTGAGGTCACATAGTACGGCACGTAGCATCTGGCGCTAACGAAAGGGAC
TGTGCATTCGTTCGTGGCGGTGCCACACACATCAGCTGTAAACTGCCATGTGGATGCGGTAGTGCCGAAGCCAGTACCTGTTGTACCAAGCATGCCGGGG
TGCGTATGACCGTACAGAGCTGTTGCTGCTGTAACCCCGTTGATGGCACCGGATGCGCCTGTAGTGAACACATAGCGCCCCGAATTGTAGTTCAAATAAA
TAAATCCTTTAAGGTTTTTGAGTGGTGGTAGCTTCGCACAGCAATCGCTAATGTCCTTGAGGCGGACTGTTGCCAAAGTCATGAGAGTGAGGACATCGTT
TCCGACTGCAACAGCACCCTGAGTGTAGTTGACGCTTCCTTTACCTAAGAGCGGTGCATTGTTGATAATTCCATTCAAAGTGGTTGTGGCATCTTTTGTG
TTCGAGGTGTTGTTAATGAATTGTGCACGAGTTTTGAAGCCCGGATTAGATGCAGTAGGTAAAGTGAAGCCAGTCACAGCTGATACGCTAGTTGCAAGCG
GCAAGTTATCGAGACTGGTGTAGGTGCTTGTGCCATCCGGCGCCAGTTGGTAATCGTCTAGACTGATCCCTAGCGACGGTCCCCAGTTGTGAAGCTCACT
CAGCGACCACTCGGTTAAGATCTTAAACGTAGTGTCTGAGTTTAGGTAGATCTGAGCGCTCTGTATCGTCGTACCCCCAATAGTAATCTGAGCTGAGTCA
ACGAACTGATGGAAGCCGTTCTTGATGGTTGCCATCATCTGGTTGATTGATGTAGTCGTAGCAGCTGCTCCAGTGTTTGTAATGCGGAGCTGCACCGGAA
ATTGAATCAGAGCCTGAGAGAGGTCCGACCATTGATTCAAATTCGCTAGAGTGTTCAAATTGAACTGCAGCTGGCCTGTAAACACGCCTCCGTTCGACGA
ATTGTCATTAATGTAAGTCCATTTCTTGCTTTGGAACAGAACAGTCTTGTCAGGCTAAGTAACTGCCTCGTCGAACACAACTTTGTCGCTATCAGAGCTC
ATACTTTCCCTATATCCATATATACACAAAGGTGAGTGAAAAATAAATAATGCGCCTCGCTTCGCTTCTTCGTGAGCCGGCAACGACGGACAAACAACTG
TTCCGCCTAGCAAAGGCAGTTGGCATTCGTAACGTAGCTATCAGCTGGTTGCAGAACTACGACCCCAACCACAAAGGCCCGCAGGTTATCAATCTAGGAT
CTCCTCGAATGGGTGGAACGCACTGGGTTGCTGTGTACCGCGATCACTACTTCGATCCTCTCGGCATGCCTCCTCCCAGCGTCAAAGATCTCGACGAGAA
GCAGTGGACCACCATCGATGTGCAGAAAAGCTCATACGGACACTGTGGACAGTACTGCATCTACTTTCTATGGCATGCAATACGCAATGACGTCGACGGA
TTCTATAGCGACTTCGACGCGTACGACATCACCTAGCTGATGTACAAACCAGATGCTTTCAGAGCCTCATGCTTAGTTTTTTTGCGCTCAGCAATGCCAA
CCCCAGTCATTCTTTTGAGTCCCGATCTGAGAGCATTATCGACTTGCGGTTGACCAGTGTACGCACCGAGAGCTTTTGCTCCTTGATCCGCAGCTGCGGT
AAGCACGCCAGAGTCCTTCAACACGTTCCAGCCTGATTTCAGCCCCTTCCAGATTTTCCCCCAGAAACCCGATCCCTCCATTCCTCTCGATTGGACGTGA
TGCCATACGGTTTCTGCCAGCTCACCTGGAGTCAAGTTCAACGTGCATCCCTTCTTCTTCACCACCGAGCGTTCTAGCTTCTTCTTGTTCTCAGGATGAA
CTGACAACCGCCCCTTGCCGAATTGCCCTGGAGTCAAGCGAATGCCTCTTCCTTTGCATGCCTTGTGAGCTTGCGACTCATTCAAGTCGATTGCCAGGTA
CTGGTACGTCATCTTTCGCTATATTCTCTGTCAGCAAAAAAAAGTCAGCAAATTAATTACGCGGGTTTTCACTGTAAACGAGTTAGGCAGACGGTTCGGT
CCGAGACGCGCTACGAGGTCCTGCAGAGTCGCCTCCCAGTCGATCGTATTAACGCTTTTTAGATGCGTGATCTTACCGCTGTTTCTTGACCGAAGTGCTC
CAGTCACGTCGAAGTACCACGTATGGTTGTCGTCACTGGCCTTAAACACCGGAACGTATCTTTCCCCGCCAAGCTCTAAAATTGCATCCTTGACCATGCC
TCTGAAGTCAGCTCCTTCAGTGTCGGCTTGCACTGCTTGCGACGAGTCGGAATGAAGGTCATCACTCGTCTCCACCTCTCGTTGCTTTGGGAAGCGTCGT
TCGTCTCGAAAACGGAGATACTCTCCGACGTCGAGGTTGTCGCGCTCAGTCTCCTCGAGGTTTTGCAACGTCAGCCTCCAGTTGATCCGTCGAGCGATTG
ATGGACGATTGTGGCCCGTCTCCTCGCTGACGAACTTGAACTTGCCGTCGCTGAACACGATGCGGATGTCGTTCAGTGGCTCACCTTCGTCCCACAAGTT
GGAAGTGTTTACCACTGGTCGGATCACGATGGTGTGATCGTCGCCGAGCTCATTGATGCGGTTCAAGATCCGACTGATATGGAACTCTGCTGAGGCAGCG
TCTGTGCTCACGTCATGTGAACGGTTCTTGCTCCTCAAGCTGGTTTCCTCACTCTCATCCTCAGATTCAGATCTAGAACGACCTCTGTCTTCCTCTGACG
TGTAACCCGTGTCACTCAGCTCAGGTTCAGGCTCAGAAGGGAGAATCTGCTCCAGCCGCCGTCTTAGCACCTCATCCGTTCGACCTCGTCTCTGACTCTG
CTCAATTCGCCCTCTGAGCGATTCGATGTCTCTCTGCCACTCTCGCTGAGAAGGCGCTTGTCGACGATTACGCGGCGATTCAAGTTCGTCATCTGATATC
TCGATCACCTCGCGCGGTGGACTCGGAGGGCGAGGAACTTCAACCACGTCACTGTCTGAATCCGATTCTTCAGCTTCTGCCAACTCACGATGCTGTCTAG
CTACTTCACGTCTCAAATCTACTGCTTCTGGGGTCAACATGTCAGGGCTATTGTAAAGTTGGCTTAGCTGAGCGCGTCGCTCTTGCCCCTGTGACCTCTC
ATGCTCCATTTGCTCTGTGACAGCTGTATCGATTTCTTCTTCAACGCCTCTGGTAGGTTGGAGAATAGTTCTTGTGCGACGTTCTCGCTGGTCTCGCTCG
CGTTCTCCTCTCACCAACGCCAGCGTCTCGTCAAGAGTGAGATTTCGCTGAGTTGGCCGAGACAGTGGTTCGCGAGGCACGACTGGAGGTGGTACGTACA
CAGGCGGTGTTACCGTGCGAACGGTTGTGTAGGTTGGTTCAGGTGCTGGAGTAGACGGAGGAGAAGGAGGTGGTGACTCAAAGGTAGGAGAAGGAGGTGG
TGTAGGAACTATATCATCGTCTCCAGCAGAAAAGGTCTGCGTTTGCAATGGCTCGTCTGTCACTGTTTCACCTGAGAACCGACGTTCACGCGATGTCTCG
ATGGGAGCCACCAGCGTATTGTCAGTCGAGGTGACATTGACTTCAGAGCTCATCGGTACGTCACTTGACGGCTCAGCGTACTCAGGTACCTCTCCCATCA
CTCCTTCAAGTTGCTTAGCTGTTCCGAGAGTAGCTGAGCTCTCCGCTGCTGCTTTGGCGACACTAGGATCAGCTGCTGCCAGATGTTTCCATATGTGCCG
AGCCATGTTCGCCAGTCGCTGTGCTTGAGCTGCTTCTGTAGCTTCCTTTGCTAAGCTATCGTACAATGCAAACTGCGTCGCTTCATTGTTTGTCTCCTCG
TCGTCTCTCGCATGGCGATATTGACGAAGTTGCGCCTGGTTCGAAGCATACATGCTATATTCTCTGGCAGATTACTTTTTAGCTTTTTTGGCTGCTGTTC
TAGCTTTGACCGCATCTTTAATGCATTGCTGTACGACTTTCATGAACTCCTTTTTCGCCTCTGGATCACCTGCAGCCACTTTGTCCAAAAACGCTTGACT
GAATTCGATCGCAGAAGCGCTCTTAGCCTTCATCTCCGCCATGCGCTCGTTTAGCTTCGAGCGGAACGTAGCGTGGCTCAGGTTCCTCTGAATATTTTGG
AGTGCGGGGCTTAGCGAAGAAGAGGGCAATGCGCGGAATTCTTTAATCAGCTTGTCGAGGTACTTTTCCTTTATAGCTGCAACAATCGGATCTATGCTTC
CTACCGCCTCGGACGGCTCTGATGGATCCAATATTTGACTTCCAATACGTCTGGCACTATTTGCAAGTCTCGAGGCCTGCTCTTCTTCTCCAGCCTCTTG
AGCGAGCAGCTCATACAGTCGCAGCTGTGTGGCATCGGAGTTCCTTTCTTCTGCATCCCGATCTTTACGGTAGCGACGCAAGCGCTTTTGATTTGAAATG
TACATGCCGCATATATCTATTCTTGGATTTTTTCTATGCGCAGCTGCAGAATTATTGTGACATCGGGGTCGAGAATGTTGAGAGGGATTAGATACTGATC
GCAGAGCTGCACTGTGATCTCAGACCTCCATCCACTTTGTTGTGGAATGAAGCGCAAAGCCGTCGGCATGCTTGTTATCAGATTGGCGTAGTTGGTGCCT
GCTGGGCTAAACGAGTGTATCACCTTTGAGCTTGGAGCGTATGGATTGCAGCAGCTGTCGAGAGTGACTACCACATTTTTCACGTCTGACACGACGGGAG
TTGAAGTTGAACTTACAGTCATGATGGTCGAAGGCTGAGACGAGGGGAACGTTCCGGTGGCGAAGCCTATGACTTTGCCGAATGCTGGTGATGCGATCGA
GAGCTGCGGACCTTTCGACGTTGAAGGGAATGTCAATTGCGGGCCTGCTGTGAATCCGGAAGGAAGAGCGGTTGGCACAGGGTACGAGATGAACTGAACT
TGGTACGTGCTCGGGTTGACCACAAACTTGCAGTAGACGGTCTGCTCGCCTGTTGAGTTATTTGAAATGTAGTAACCCTGGCTGACGAGGTACCAGAAAA
GATAGTTGTTAAGGTCGGAAACGTTGTAACCTCCGTCAGGGATCGTGAGATTGAGCGTGATGGTTCCAGACGACGTCGGGTGAACAATGCTGAACGAATT
ATTGGCTTTGACTGCGGTGATATTCGGCCAGCTGAACCAAACTATAGCTTCTTCGAGTGCGATGCTCACATGGGTCATTTTGACGGAGGTACCGAAACTG
TAACGGAACGAACTTCCTCCTGCATAGTTGCTTTTGTTGATAATGATCGGGTATGTCACGCTCAGAGTTGGATCGCCCCGCCGGTTATATTAGGCCTAGC
AATTCTTTTTTTAATGTCAATCAACAAAGTGTTGAGAGAATTCTGAGTATTCTCGTTGTAGACGCGAGTGAACTCCTCCAGATTTAGCTCAGTGGGAAAA
CAAGTCAAGATCAGACGGAGATCTTTGTTTAGAAGGTTTCTTCCGAGGATGAAATATTGCACATTGTCTAGTATCATCTTAGGTATTTGAAAGAAGCTTT
GACCGATGTACAGCATTGAGAAGCCTAACTTGCACCCCTTTATGAAATACTGTTTCGCTTGAACGTTTCTAAAATCAGATCGTCGAAGATAATGAAGCGG
CTGGTACTTGTCTATCCGCTTGAGCTTGTTGCGCTCCTCATCCTTGATGCTGTAGTTAGTGGTCGGAGGCACCGCTCCGTCTTCAAAAAACAGCACAGAC
TTGTTGCCGAGCTTGTCGAAGAGATGATTGTAAAGCGGCTCGTCTCGTGACTTGACGCACACGATGATCTCGTGGAATGTCTTGTTCATAGCGACAATCA
GGTTCAACAGCGCGTTGGTCTTCCCCGAGCCACTTGGAGCTGCAGCCAGCGCGCGGAATGGCACGTCGATCCCTAGGATACCTACATTTGGGTTTATCAC
ATGCTCCCTTTTCGTGTATTGATAGAAGTTGATCATCTCTCTATATGGCGGTACAGATTCATATAAGGATGGCATCGTACGCCGCCATTCGTCCCACCGA
TGTGTTCAATACATCACTGTTCACCAAAAGCACAGATGGTCTGACTTTAGCGAATGCAGATCAGCGCTACATCCGCTCTGGATCGACAGCAGCTGTCTTG
AGTCTTAGCTGTTCAGGCTTGGCTGACGTCGGCTCTCTCAAGATCGGTGGAGCTACTGTCGACCTTACGCCAATCTCAGGCGTAACAGCAGGAACAGCTC
TCGGAGGGAAGGCGCTTATTGTCGACAGCTCACGCAACATAGCGAATCTAAACAATGTCACTTGCTCGGGCCTTGCAGCCCTCCAGAGTGACCTTCGGCT
CGCGTTCGAGTCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTTGACTGCCTTACAAGATCGGACCCCTCCACGCTCGAAGAGGCATT
CGCCCTCGCCCTACGCGAGGACTACGTGGTCGCGGCGTCATACGCTCACGCGCTACCTGCTTCAGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGAC
GCTATCGATGCGACGAGCAATCGTCAGCGTCATCTAGTGCGTCGAAGCGGTGCTTGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTC
ATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCAGTGCTTGCGCATGTTGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGT
GCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGTCCCCCGGTAACAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCA
CGCCGAGAGATTCAAGATTGATCATTGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGTGCTCCTTGATTCAGGAGCGACCAACAACTTCTT
CCGCGCGTCGTGCTTGTCGGTACTCCCGTCGGACATCACTGTCCGCAAAGGTAGAGGGGCGGTCGCTGTCAAGTTGGCCGATAGGAAATCACGCCGCGTC
GCGCGGCGCGAGATTACACTTCCGTACACGTTCGACGGTTTCCGAGAGCAACGACGACTTCCTCGTCATTGAGATGAACTACGCGTTTGACTGCATCCTG
GGTATGCCGTGGTTGACGCGCTATCAACCAGAGATTGACTGGTTGGCCCGGTCGGTCAAGCGTCGCAGTGATTATGATGTGAGCGAGGTGTTCACGCACC
TCCCGGTCGCCCAGAAGGATTGGCCTCACGTCACCGTCCTGGACCGGTCATCCACGACGCACGTTGTGCACAGAGTGAGCGATGGCCCTCGCTGCACGGC
TTGTGCAGTGCTGTTAACTGACGAGTCCCCGCGGCGACGCGCGGATGAAGACCAACTGGCGGTCGAGCAGAGGCTCCCGCAGATGTACGAGACGGCGGTC
GAGCAGGGGCCCCCGCAGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGCAAACGAACGAGATGGTGGTCGAGCAGGGGCTCCCGTCAATTGAGCCGG
TGGTCGAGCAGTTGGCGCTCCCGCTGAACATTACCGCGGTCGAGCAGGGGCTCCCGCTAGAGGGGGGTGACCTCTCGTCCAGCGAGAGCGACTCATAATC
CTCGAGTTCGCACTCGAGGCGGCGGAAGTCGAAGCGGCGTCGACTGAAACCTCGCCGAGAGCCCGTGCCAAGTGACAGCTCACCGACGGAGTCGGTCTGC
GTGTATGAGTACGTGGAAGGTATATTCGGTCGCCGACGAACACTCGAGCTTGCAAACCCACCTAGCGAGGCAGGGTCGATCACTCGACTTCCAGGTCTCT
CCTGGAAGAACTTCCTTCGCGACCTCAAGGACGATGAAATCGAACAGATTTGCCTGATCACCGACGCCGATTCTGCGTCGCTCGAAGTGAATGCAGTCAG
TGACGGCGACGCTCCCTCGCGCCCAAAGAGCGCTGAGCCGAAGTCGGCCCGCGAGAAGCGCTTCGCAACGCAATCTTGGGAAGCGCTACGCGAATCCGGC
AATCCAGTCTACGAGTCCGCCCGCAAATATGAAGATGTCTTTCCGAATAAGATCCCAGCTGAGCTACCAGCTGACCGAGGAATTCGCCACGAGATCGATC
TCGTGACCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTAGAGAGCCGCCGCAAGGCGGG
TCATGTGCGTGAGAGCACATCGCCGCACTCCAGTCCGACCTTCTGTGTGAAGAAAGCCACGGGTGGATGGCGCATCATCCATGCCTTTAGCAAGCTGAAC
GACGCTACCATCCCTGCCCAAACGCCGATTCCTCGGAAGGACATGGTGCTCGACGCAATGTCGGGTAGTGAAGTCTTCAGTGCCATCAACTTGACCGATG
GGTTCTACCAAATACTCATGAGGCTGAGCGACATACCGCTCACAGCGGTAAGCACTCCCAGTGGTATGCTCTGGGAGTGGCTTGTTATGCCACAAGGCTT
GAAGAATGCTCCCGCCACGTTCAATCGCATGGTATCCCATGTGCTGCGCCCGCTCCGCGATTTCGCACCGAGTTATTTCGATGACATCTTCGTACACAGT
CGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGCTGTATGCCAACTTGAAGA
AGTGTATATTCTGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAACGGCGTCCGCGCCGACCCCGAGAAAGTGTCGTCGATATGTGCGTG
GCCTACACCACAGAATCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCATAAGTACACGAAGAATTACGCCGGATTGATCCAGCCGCTC
TCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCCGCCTTCGACTCGGTGAAGAAGATTCTCGCCGAGGCCCCAATCCTCG
CGCTCCCGGATGACTCGAAGCCTTTTCACGTCGTCTGCGACGCGAGCGATTTCGTCATCGGCTGTGCGCTGATGCAATTCGATGAAGAAGGTCGAGAGCG
TGTCGTAAGCTACCAGTCCAGGCAGATGAAGCCGGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGATGCGCTACGCTCTGATCAAGTTC
AGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTATACCGACCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATCTCTCCCAGCGGATGGCCC
GCTGGCTTTCGTTCTTCTCTGAGTACAACTTCGTTGTCCACTACAAACCCGGCAAGAACAACATTCTCGCCGACGCTTTGTCTCGGCGTCCCGACTACGA
CCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCAATGTGCGAGGCGACAGGGGTCAACCTGACGAGCGTCTCC
CCGGTAATGCTACTTCGCGACGAGATCCGAGCTGCTTACGAACATGACTCGACGTGCTCCAGTATCCTGAAGCATCTCCGCTCTCCCAGCGCCGACACAC
TGGGAGCCCTTTCCCGCTCTGTATGAAACACAATCCACCGATATCGTCTCGAGGACGAGCTGGTGACGTACAGCATCGACAACTTCGATGCCCCACGTGT
CGTTGTCCCTAATGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACATTTGCCGCC
GTGTCACGCGACTTTTATTAGCCACACCTGTACAAATGGGTACGTAAGTGGGCGCGCACCTGCGAGACCTGCCAGCGCGTGAAACCTGCCTCGTCTTCGC
AGGCTCCCTTGCGTCCGCTGCCAGTGGCCACCGAGGCCTGTCGCTCGGTGTCGATGGACTTCATCTTCGGGCTCCCACCCGATGCTAAAGGACGCTCAGG
TGTCTTGGTGTTCGTAGACCGCTTCAGCAAGATGGTCCACCTGATTCCGATGTCGGATGCGATCACCGCGGCAGATACCGCGGTGCACTTCCTTGATGCC
GTCTTCCGTCATCATGGCCTTCCCGAATCTATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCTGGTCAAAGCTCTTCGAGCTACTGGGCTCGA
AGCTAATGATGTCCACAGCAGCACATCCGGAAACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGAAGCTACGCGACGTCGTT
CTCCAGCTGGAGCTCGTTTCTGCCACTGGCCGAGTTCGCTCTGAACAAACGCGGTACACGCGTCGACTGGGCTGACGCCCTTCTTCGTTAACAACGCGCG
ACACCCGCCTGTCCCTGCTCTCCTCGCCGTGAGCCATCCACAGCGCCGTGTGTCTCCACTCTGGGTGGTGAAGAAGCTGCCGACAAGCCGTCTACTCCAT
CTGCGATGTCTCCGGCGGCTACACCGGTACTGGGTCAACCGGTACATACACCGGTTGCTAATGATATCTCGAGTGTATCCCCTGTTCCCACGTCGGTCAA
CGCAGTGACACGCTCCGCATCGAGCCCACTTGCGCCAGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGACTTCGTA
CTACAGCGCCAAGCGGTCACCCGCTATGTTCGTGACGCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGATAAGGCTGGCCGCAAGAACACAG
CTACGTTTACGACAGGCGAACGAGTGCTCCTGTCGACTGAAGGTATCAGAAACTCTGCGGTTACCAACCTCGGCCGGAACAACCCCGCGCCGCGCTTTAT
TGGGCCGTTTACGGTGATCAAGACCATTGGTGACGCTTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGACGTTCTACGTCGGACGTTTAAAG
AAATACCATCCGTCCGAGATCCCGGACGCTGATTTTTCCTCGAGTGACGCGGCAACTTTCCAGCGAGATGGTCCTCCTCCTTTGATCGACTCTTCGGGCG
CTCGGCGTTGGATCGTTGAGTGAATCGT