Description :
From Genome Similarity Track
Location :
Scaffold_19:91986- 95031
Sequence
3045 bases(100 bases per row)
ATCAGCTCATCGATGGACAAGGTGTCCTCGATAAGAAGACTCGAATTGAACGTTACACGTCTCAATCCTTGGAGTCTCTTCAGACAAATCCTTTGTATAA
AGATTTGATCAATTCAACGATATGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGAGAAAAAATCGAGCTCAAACCGGGATCGA
AGTACTGTGCCATGAAGCAGTGGTCACTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTACAGGTCATGTGAGGGAGTC
AACTTTCCCTTACAGCTCTCCGGCCTTCTGTGTGAGCAAGGCCACAGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTGCAACGGTACCA
GCTCAGACGCCGAGACCGAGGAAAGACGTCATCATAGATGGTATGGCAAAAAGTACCACCTTTCGTCCATGGATCTGATGGATGGCACTATCAGATCCTT
ATGCTTGAACGAGATACCCCATTCACATCAGTGAGAACCCCCAGCGATATGCTCTGGAAATGGCGGGTTATGCCACAAGGGATTAGTAATGCCCCAGCCG
CATTCAACAGATGCGTCACAAATCTGTTGAGACCGGTGCGAGATTTCGCACCGAGTTACTTTGACGATAAATTCATCCATAGTTGGACTCTGGGCGGAAA
GAAGGATGTAGAAGTTCATAGAACACACGTTCGTCATGTCTTTACACTTATGCGAAAGCATAAGTTGTACTCCAACCTCAAGAAGTGCATATTCGCTGCA
AGCGAAATACTACTTCTTAAGTGAATCGTGAGTAAACACGGCGTGAGCCCTGAATCTAGAAAGATCAAGACGATTACCGACTGGCCTTTGCCAGTCGATG
TCAAGAGACTCTGAAAAATTTCTTGGACTAGCTGCGTACTTGCACAAGAACTCGCGCAACTACGCCGAGCTGACCGTTAATCTCTCTCGCCTCTTGAAAA
ATACGAGAAATTGTCACGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATTAAGTAGAGCTTGATGAAATTGCCAAGATAGGCAATTGCAGACCAAGAC
AGACCATTCAATGTGGTCTGTGACGCCAGCGATTTCGGAATCGGCTGTGCGTTAATGCAGTGTGATGCATACGGCTGCAAGCAGCTAAGCGCAATTACCC
AGTACATGACAAAAAACGCCTTGCCATGAAATACGCAGTGGCTAAGTTTCGCCTCTATCTCCTAGGAGATAGACCGTTCGTGGTCTATACGGACCATGCG
TCATTCCGCACGGCCGGAAACAGCCCACACCTCTCCCAATGGATGGCGAGGTGACTGTCCTTCTTCGCGGGGTATAACTTTTCCGTGAATTTAGGCCAGG
ACAACTTAATGTCGTCGCTAATGCGTTGTCATGCCGACCCGACTTCGAGTCGGCTGCGCGACCCAACAGTAGGATCAGTCCCACTGTTGCAATACTAGTC
ACTAGTCTTCCGTCGTCAACAACAGGTTGACGACATAAAGAAGGCCTAAGCAGAAGATAAGGCTCTTCTGCACCTGATGGATCATCTAGTGAATCCATCT
CTCAAAAATTTACCGAGCTTGTATCGATCGTCCGCGGATTGATACGCAAGACGCAACGGGTTGCTGTTTTATACAGCCGTTGCCGGTGACACTCCTCGTG
TCGTCATTCCCGCTCATAATGGTTTGCGATTGCGCATCCTTTATGAGTGTCACGATGCACCAACAGGTGGGCATCGTGGTAGGGAAAAGACTTATCTCAC
GGTAAGTCGCAACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGCAAACATTCGTTCTTGCGAGGTGTGTCGACGGGTGAAACCTATTCCTTCATCCCG
AGCGTCGCTATAGCCCCTAACAATTCCGGCAGAGTGCTGGCAGTCCGTTTCAATCGACTTCATCTTTGGGTTTCCCGAAGACGCAGATAAGAAGAATGGT
ATTCTTGTGCTCGTTGATCGATTCAGCAAGATGGTACACCTTGCTGAGGTTCAAGAGTTGATCACAGCACAGGGCTGAGCTTGTGTCTTAATTGAAACGG
TATTCCGACTCCATGGGTTACTCCGGGAACTAGTCTCTGACACAGGTCCACGAATGACGGCGGAGTTTTAGCAATCCGTGTTCCGATCACTCGAGACACG
TCGAACTATGCCCACTTCTAACCATCCGGAGACTGATGGTCAGACGGAACGCGTTAATCGCGTCCTCAAAGAAATTCTTTGCGGTTACGTCCAATCTTTC
ACAGTTGGGGTGACTTTTAGCCGATGGTGGAGTTTGCAATCAACAACTCCGTGCATGCATCGACAAGGCATACACCATTTTTCGTGCACGGCTTACGCCA
TCCACGCCTATCCACCCATTTAGAGTGTGACAATAATTCAAGGGGGGAGGGATTCGCTCGAGCAAAAACCGTTCTGGCTCTTGCTCATCACGCGTCGAGG
TGATCGACGACGCGAACGTTGCCAATGTCGATCAAGTCGACATCGAAGAAGATAATCTTATCAATAGCGACGACACTTTTGCTGATCTAGATGAGGAAGA
CGATGTCGGTATATTCAGCATCACCAATGAATACACCAGCCAGGATGAGAACACCCTCGCTAAAGAAGAAAATGATCTCTCTGCAGTGCGCACAAGGTGC
ACTGCAACAAACTAAAGTGATGCAGCAGAGGATTTTCTGCTAGCACGAGAAGCAGTGGTCCGTTTCGTGCAAGACTTCACCGCGTTAGCGATAAATATGG
AAGAGCAAACGTTCTTCTATTTAATGTTGAAGACATAGTGCTACTGTATACGGAAACCCTACCTAAACACATAGTAACTAATGTGGGTAGTAGTAAACTA
CTACCCAAGTACATCGGCCAGTTTCGTGTACTACATCGTAAGACAATGCGTATACTATCGAGTTGCCTCGTAGGATGCGTACGTATCCTACGTTTTATGT
CGGGCGTCTCCGCCCGCACCATCAGCACGAGGTTTCTTCCTCTGG