Description :
From Genome Similarity Track
Location :
Scaffold_39:91969- 93664
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14231hypothetical protein

Sequence
1695 bases(100 bases per row)
AGTAAGTATCAACCTACCGGTGCATCTTGCAACGAACAGCGTAGGCTTCAGATTCTATCGTCAATATACCTCGGTCATTGACATATTTCGTAGTTGGAAT
TTGATCCATGCAGCAAACTGCATGGGGAATCCAAGGCTTGAAATGTCCGAAGGAACTGACTGAAATGTGTTCTGTTTCGAGTGGACCCGAAAGTCCGAAG
GCACTTGCTGTCGCACATCGAAAATGAAACCTGTATTTTGGCAAGTCTATGCGTTAGAAGAGGTCCATGTGTCATCACCTCCAAACGGTGACGCGCCGTC
CGTATCGTACTGGTCTACGCCAACAGCAAAATGCAATGGTCCTGTAGCAGCACCCCAAGCCAACACTGCTAAAGCAGCAAAATGGTCTGGGATGTGGAGC
GTTTGAAATGGATGGGGAACTCGCCTCCAGCGCATCTGGAGGCCAACCTTGGTCGCAATTGTTGGTCCTCGGCTACTTTACCAAGTACTTCCCCACCCCA
AGATACGATCTAACCGCAGTTGAATCTGGTCAGCAAGTGTTGGTGGTAATTGAAGCTTCCTCCTCAAGCCTCTTCTTGTCTTTCATGGCAGCCCTTTCGA
TGACTGGCAGTCGCCAGTGGTGGCCGCATGCAGCATGCATGTCCTTGTCGCTTGGGCGGTCCGCACCGATTGAAGTTGTAGCCAACCCCGAGCCACTACG
TCATAACGAAAAGCATTCCCTTTGCGGTGGGTTAAACATCACATGCAGGGATTGACTCGATTGATGCGCTACATGCAAGCGCCTGGATATCATGACAGCA
AGCTTGGATGCAGCTTGCCTAACACTGGTTGTGCTGTTATCCTACATTTCAACAAGCCTCGCCTTCCCGGCGTGTCACCAGCATTTGCCGGACAGTGGTA
TCCACCACCAAGTTTCTAGCACCGGATTGGTGCAAAATACGGATTCAACCGTCGCAGAGACCTGAGAGTGGTGACGCACTCGATTTTGTCACTTCACCGC
TCGTGACGACACACACTCATGATCATTGCTGAAAGCGCATTCGTCTTCACTTTTCAAGTCGCTGTTTGCCACAGGACCATCACTCATGGCTTTCACCATG
CAGACACAGGTGAACTTGGCGTCTCCTGCTTCGCCGCTATCGCTGCGGGCCACGCCGCGAGTTGTAGCCACACCGCCGAGGAAGTTGAAGAAGAACGAGC
CAGTCACCAGTGCACTGGTGCTCGTGGCCGTAATCTTCTTCGGTGTATTGTTGGCCCTTATGCTCATGGCCTTCTTCGCCTACGCACCACTGCTGTGCGC
GTCCTGGCTCGGCATCTTGTACGTCATCGGGCTCTACTTATCCACCGAGTCCAAATGGCGCTGGCACGACGCGCAGGAGTTCGAAAACCGCTTCTGGACC
GGCACCGCCTTCATGTTCAGCGCCGCGGTGCTTTACATCAAAGACTCACCGCTCGCCGTCGGTCAGTGGAGCTCCTCGCTCGGTCTCGTGCTCGTCTTCG
GCTTCACCTCGAGCGTGCACTATTTCGACAGATTCCTGCACCGCCAGAAGATCAGTCACCGCCCGAGACTCAAGCTAACCACCCGACAAATGTCATCTAA
TTTATTCAAGTACAAAGCCACAGCCGAAGAGAAGACGCAGCTCGTCATGGAGTGCGTGAGTCGCATCGACCGCCATTATTTACCCAGTACCATAA