Description :
From Genome Similarity Track
Location :
Scaffold_645:9193- 10657
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_645-snap-gene-0.13Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_645-snap-gene-0.14Lipoprotein, type 6

Sequence
1464 bases(100 bases per row)
GCCGGCATTGAACTTCTTGTTGCTGCTCTTCTTGGCCTTCTTTGGCGACGCAGTCTCGGCTGGGGCCGCAGCGGTCTCTTCCACAGCAGGCTTTGGGCGC
GACGTCTGCGCAGTGAACCACTCCTTCTTTTCCTTGATCGCAGTGAGCGTCTCCGACAATGCACCAACGGTCGATGGCGGCACGACGCCGACCGACGTGA
ACGCGTCCAATTGCGCGAGCGGGAACGAGATCTTGGCCTCCTTCTTCGACTTCTTGCCTGGGCCGGTCTTCTTGCCCTTCTTCTTGCCACCGCCGAACGA
CATGAAGTCTTCGTCCTTGCGCTGCAATGGCTTCAGTCCGTCCAATTCTACTGGCGCCGCCGAGGCAGCCGCCGCTTCCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCCTCATCGTCCTTCAGCTCCTTCGCAAACGTGTTTTCGAGGAACGAGATCAGCGCGGTCGAGAGGTCGATTTCGTCCTGGTATGGGTGAATC
TTGGCCATCTCCTTTTCGTAATCGGCGAGCTTGGCTTCGTACTCGGCCTTCTTCGCTTCCTCCTCCTTCTTGCGCTCCAGGTCCTTCTTGAAGCGCACGA
GACGGATGTTCTGGTAGTACTTGTTGTTCTCCTCACGGAACGCGTTGCGCAATTCCTTCAGCGCCGTGAACTTTTCATCGAGCTTCTTCTTGATCTCCGT
GCGCTCGTTCGCGAGAACTGGGAACTTGTCTTGCTTGTTCTCTTCTTCGTTCAGCTTGTACAATTCATCGAGCACGAGCTTCTGTGCCGACAGCTTCTCT
TGTACGGCGTCGATCTCCAAGTTCTTCGCGGCCTGCTGCGCGCGGATGTCCTTGATCGAGTCGTTGTGCTTGTCCACAGCGCCCTTTTCGTCCGAGAACT
TGCTCACTTGAAGCTTCTGTTGCTGCAACGCCTCAATCTCCTTGATGATGCGCTTCTCCTCCACGAGCGTCATGGAGCGGGTCTCCTGCTGGTGGCGCAG
CGACGCGATCTCCTTGTCGAACTCTTCCTCAGAGCTGAACTTCAGCGCCGAGCGAAGACTACGCTGGTTCTGCATCGTCGCGTCCTTCAACGTCTGCACG
CTCTTGAGCTTCGCGGTGATCTGGTTGCGCTGCTGGATCAAGTTGTCCTTTTGCGCGCGCAGCTCGTTGTACACGGCCTTGGCGGCCTTGATCTGCTCGC
CGTACTTACCGCGGCCGCTCTTGACGGCTTCCAACTCGGCACGGATCACATTCTACACATCGAAAAGTGTCCATATCGACAGCGCAATGTCAGTAAACAA
AGCTGTACACATGCACACATAGGAAAAGAAACAGCATACAAAGCAGCATGCAGACGTACCGTGCGCGCCTGGAGCTTCTTAATCTCGGTGTCGATCTTGG
CGATCTCGGCGTCGTGCGCGGCCTTGTCAGGCTTGGGAAGGCGCTCAATGACGTCGGGGATGTC