Description :
From Genome Similarity Track
Location :
contig_21:91928- 93426
Transcript NameFunction/comments
g3839.t1hypothetical protein

Sequence
1498 bases(100 bases per row)
CTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGATATCATCCACTGAAGCACCCATGCTCTAAACCCACCACATCACTGGGTACCGGACTAC
GCTACTCCTAAGGCGTCAAATCTCTTTTATCGCTGTAAGGTAGCAGAAAGCTTGGAGTTCCTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGTGGCAA
TAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATCGTGCTGTGCTTCATGGATGCCTGGGTCATGGCATCCAATGCGGCCTCAAAATTACTGG
GCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATTGTACACCTTGCCAGTCTCCACATGTAGCTCCGCGACACAAGGTCTCCGGCACCGCACT
CGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGATAGGAAGCCAAAATGTGACAGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGAAAGGC
GTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACCAACAAAGTGCATGTATTTAATACATGCTAGCTACATGAAGTCAGGTGTCGCGCGACCG
CGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACATGCAGACAGCCATCCTTCGGAGCCAGACGGCTCGTTTCTGGTCGATGAATCACTGGCCG
CGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAGACGGAGCGCCGACGTCGATCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAGGCGGT
CGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAATACGGACAGATTCAAGCAGGACCGTGCCCCTGTCATACATTTCGCAAGGCTAACTTTG
CACCGGTATCGTCTAGAGATGAACGTAGACCGAGGCCTGGCCCGTGCGTGCGTGTTGCGCTGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTCTCGAC
GAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTCGCAAGTTACCACCAAGGCCCAAAGCCGAAATGGGAGTGCAACCTGAAGTCTTGCCACT
TCGTGTTCAGCGATCACAGCCGCGGCCCGCCAAGTCCCCGCGAGGTCTCTCAAAGCGGCCGAGTTTCCGCCGCTCCAAGTCCCTACCCATTGAACTCCCA
GAAGACGTCCGCCTGCTCAAGCAGAAGATCCTCGATACACACCCGGCCAAGCTGACGCGCTTCAGTCTGAGCCACATGCGCCACAAGGCTATCCCACCCG
TACTCATCCCAGACACCCTGAGCGACCGACGAGCCATGCGAACGCTCGTCTCCGGCAAGACCGTGCCGCTCACCATGCACATGTGGGATAACTGCAAGAG
GAAGACCAAGCACCTGGATATGATCGACGAGTACGTCACCTACCGGTGATAGCTCCTCCACCCGCATCAGTTCTAGCTAGTCCCCTCGCCTCTCCCTT