Description :
From Genome Similarity Track
Location :
Scaffold_17:919256- 921962
Sequence
2706 bases(100 bases per row)
ACCGACGTCGATTCGGCGTTGCGCAAGTGAATGCTGTCAGTGACGATGACGCTCCCTCGCGCCCAAAGAGCGCCGAATAGAAATCGGTCCGCGAGGAGCG
CTTCGCAGCGCAATCTTGAAAAGTGTTACGCAAATCAGGTAGTTCAGTCGACGTGTCCGCCCGCGAATATGAAGATGTGTTTCCGGATATGATCCCAGCT
GAGTTACCAGCTGACCGAGGAGCTCACCACGAGATCAATCTCGTGCATGACCGAATATTGTGTGATATGGCAGTGGCTCCGCGAGATCAGGTCCAAGCAA
TTGACGACTTCTTAGAGAGCCGCCGCAAGGCAGGTCATATGCGTGAGAGCACATCGCCGCACTCTAGTCCGACCTCCTGTGTAAAGAAAGCCACGGGTGG
GTGGCGCATCGTTCATGCCTTCAACAATCTGAACGACGCTACCCTTCCTGCCCAGACGCCGATTCCTCGGAAGGACATGATGCTCGATGCTATGTAGGGT
AGTGAGGTCTACGCACCATTGACTTGACCGAAGGATTTTATCAAACCCTAATGGGGTTGAGTGACAAACCGCTCACAGCAGTAAGCACTCCCAGTGGTAT
GCTATGGGAATGGCTTGCAATGTCACAAGGCTTGACGAATGCCCCCGTCACGCTCAATCGCATGGTCTCCCATGTGCTGCGCCCGCTTCGTGACTTCGCA
CGGAGCTACTTCGACGACATCTTCGTACACAGTCGCGCTGAGGCCTCCCTCAGCGCGCTCGAGGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGA
TGCGCAAAAACAAGCTGTACGCGAGCTTGAAGAAGTGCATCTTCTGCGCGCCGAAATCTCCGGTACTTGGCTGCTTTGTGAGTAAGAACCGTGTCCGCAC
CGACTACAAGATAGTGTCGTCGATATGTGCGTGGCCTACGCCACAGAACCCCACTGAATTGCCTCAGTGGTTGGGTCTCGCAAATTACTTCCACAAGTAT
ACGAATAATAATGCTTATTGCTGGAATAATAAGATTAATCCAGCCGCTTTCGTCGTTATTGAAAAAAGATGTGCCGTGGTCGTGGGCTACCGCACATCAA
ACTGCCCTTGACTCGGTACGAATCCGGAGACGGCTGCGGAGTCGATTGGCCGCGCTGCTTGCTTTGGCGCGTAGCTAGCTGGCACAAGTGCGCTCGAAGC
CGCTCGGGGGCTGATCGAGTTACAGATAGTCCAAGCTGCGAGAGGAGATGCCGTGCTGTGCGGCGCTGTCAAAATCATCTTAGTTTGGGCGCGTGTTACC
ACGCTAGCCGAAACGAGCTTTGAGGTTACACTCGAGAGATCACGGACAGCCGGTATCGATACCGTTTGGCTTAGCATTGACGTTGCCGCCGGTGGTTTTA
AATCTGGGGTGGACGGCTTGTTCACAGCTTCTTTGCCACCCAGCGTGGAGACACACGGCGCCGTGGGATGCCCAACGGTGAGGAACACGCGGGTGGCGCG
CGTTATTAACGAAGAAAGGCGTCAGCCCCGTCGACGCGTGCACCGCGCTGTTCAGCGCAAACTCGGCAGCAGGCAGGAGCGAGCTCCAGCTGGAGAACGA
CGTCGCGTTATCTAGAAGAGCGTCTTCAAGGACACTATTTACGCGCACAATCCGGCTGTCCGTTTCCGGATAGGCTGCCGTGGACATCAACAACTTCGAG
TCCAGTAATTTGAAGCGTTTCGACCAGAAGGCCGACGCGAAGCGCGGGTCGCGGTCGGAAACGATGAATTCCGAAAGAACATGATGGCTGAAGATAGCAT
AGATGACGATCACCGCGGCTGATACCGCGGTGATCGCGTCCAACACCAGAATCAGATGGACCATCTTGCTGAAGCGTTCGACTACACCAATACACTTGTT
CATCCTTTAGTATCGGGTGAAAGCCTGAAGATGAAGTCCATCGACACCAAGCGCCAGGCCTCGATGGTCACTGGGAGAAACGACAGAGGCGCCTGCGCCG
ATAAAGAAGGCTCCACGCGCTGACAGATCTGACATGTGCGCTCCCTCTTACATACCTATTTGTTCTGATGGGGCCAATAGAAGTCGCGTGACAAAGCGGC
GAACGTCTTCTCGCGACCGAGATACGCGCCCAGCGGGGCATCGTGAACCTCATGGATAATCCGTGAGCGCAGATTGGGGTCGTTAGGAGCAGCGGCACGT
GATGCCTCGAAGTTGTCGATGCTGTACACCAGCCGTCCATCCTCAAGACGATAACGGTGGATACGGCTCCGTTCGGAGCGAAATTGAGCTCCCAGTGTAT
CGGCGCTGGTAGAGAGAAGATGTTCCAGGATACTGGAGTACGTCGAGTCATGCTCGTAAGCAGTTCGGATTTTGTCGCGAAGTGGCATTTCCGGGGAGAC
CCTCGTCTACATCGTCTTCTTCGAGCGAAGCTTGTCGACCCCATGCGCCGCGTGGATCGTAGTCGGGACGCCGAGACAAAGCGTTGGCGAGAATTTTGTT
CTTGCCGGGTTTGTAATGGACCACAAATTTGTACTCAGGGAAGAATAAAAGCCAGCAAGCCATCCGCTGAAAGAGATGGGGATTCTTCATCGCTGTCCTC
AGCGATGCCTGGTCGGTGCACACCGCGAAGGTATTTTCGCCCAGCAAGTACACTCTGAACTTGATCAGAGCGTAGTGCATCGCGAGGAACACCTTGTCGT
GGACAG