Description :
From Genome Similarity Track
Location :
scaffold_404:9192- 10356
Transcript NameFunction/comments
Pl_105173hypothetical protein PHYSODRAFT_321497

Sequence
1164 bases(100 bases per row)
CTGTACAGCCAGCCATTCTTCCAACACCTCCGAGATGAGTTGGAGCGTTGTGTTCCACTCCACAATTTCCTCTTCAAAGGGTCCTTTAAACGAAGAGAAC
ATCATAGCTTGTGTCATAGTGATATGCTCATCCAAAATTGCTTGGATCTCGTCCACACCCTTGATCACGTATGTTCCAGTCTCACGGTAAGCTATTATCT
GCAGGTCGACAGTTTCCCAGGCCCCCTTCATCGTTCGCAAAGCTTGTTCTACCTGATATTCTTTTCCAGCAGCCTCTGCAACTTTTACGATATCATCGAT
ACGATCTAGTAAATTGAGCTGGAAAATATTGGTTAGTGTGAAACTCTCATCGATCTCCAGTGAGAAACCCAAGCTCTTGCTAAGGTCATCCCAGTGACGT
AGGCGCATACCAGGATTTCGCAAAGCCACTATAAGTGGCACGTACGGTTTGAACACGGAGATCTGTTCTTTCACAGTTTCTGCAATCTTCGAACAGGCTT
CATTTCCACTGTTGCTGAAGAACTTGTAGGCCTTTTGAATGCCTGTGCTGTACGTATCCACAAGCTTCTCCACTTCTTCTGCATTGATATCCGTGAAACT
TCCTTGGATCCACGTTTTTCGACTCTGAATCCAGTTATACGATGTAGACCATAGTTGATGGTATGGCTCAAATGTCTTCTTAGCGCTCGCCAGTGTGTCA
TATGAAGTTACCTCCTGTCCAAACAGTATCTCTCGACTGTTAAATAACATGGCATCTTGCTGCGCTTGCTCTAATTTCCGTTGAACTGACATTGCATGAT
GTGCTACATCATCCACGAAGGCCAAGTTGTCGTAGCGAGAAAAAGTTTCGATCTCGTCTTGCAACGCAGCCAGCGTCTTTTCAAAGCGTTCCTGTTCGGA
CTCCATCTGCTTCGCAAACTTTCCCTTGCGCTCCTCAAGTGCATACTTGAAACGCGCACTCTGAGCTAGTACCTTAGAGGGCCAGCCTTGAACCTGCCAG
GTTAGACGCAAGTGCTCGTCACTCACGTAATGGTGGAAATCATCTATGAGGGTGTTGTCGCGCATCATCTGGGAGATTTCTTCCTGAAGTGGTGCCAGAA
GAGCAGGTAATCCGTTAATATATTCCTGAAGCGCAGTCAAACTCTCAATGTCCTTCGGCGTCGA