Description :
From Genome Similarity Track
Location :
Scaffold_31:91911- 101610
Transcript NameFunction/comments
Hyaar_Emoy2804709threonine dehydratase, putative
Hyaar_Emoy2804710HECT E3 ubiquitin ligase, putative
Hyaar_Emoy2804711hypothetical protein

Sequence
9699 bases(100 bases per row)
AAAGTATGTGGCTGTACTAGCTGCTGCGAACATGGACTTTGACCGGTTACGCTTCGTTTCGGAACGCTCAGATGACCGTGAACGCTTCATGGCGGTTAAA
ATTCCCGAAAAGATTGGCAGTTTCCAGGACCTTTACAACGTCGTCTGTACGTAGCCGCGGCTGAAGATTGACATAATTCGGCATCACCTACGTAGCATGT
TGTTCACGTCTTTCTCCATGTTTCAGTCCCCCACAATGTGACCGAGTTCTCATACCGTATGAATTCGGAAGGCGACAACGAGGCGCGTATCTGCATGAGC
ATCCAGACCAAGACACAGGACGAGTTTATTGGCGTCGTCAAGATGATCAACAAGCGTAACGACATGCATGCAATTGACTTGGCCTCGAATGAGCTAGCCA
AGTCACACTTGCGCCACCTTGCTGGTGGCCGTCCAGAAAACGTACGTCCCTGTGGCGATTGTGAGGTTGTCACGGCATCGCTGCCCATTGCCCATTGCTC
ATTGCTCATCTCAATTGCCCTATGTAGATCACAAACGAACGTCTGTTCCGACTCGAGTTCCCAGAGCGTCCCGGTGCACTGAAAGACTTTCTCGATACTC
TCGGGTACGTCATTTGTTCTTGACTTGGGGTTACGCTGCAGATCGATGCTGAGTTACATGTGCCTTGTGTCGATGCAGTCAATCTGCACGTCAGTGGAAC
GTGAGTCTATTCCACTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTGCACGTAAGTGTAACGGGAGCCTGT
TCTACTACTACAACCCGGCGATGACATTGCCCGTGTGCGAGTCGGATTCTAGAACCACGGAAAGATAGTGCAGTGATCCTTGGGTTCCTTGGAGGGACAT
GTAACGCTGTGAAGAGGAGACGCGTAACCCCAGTTCAAGAACAAATTCTGCACTAGCTTTACTATTCACCTTCACGTGTGTAACGGTAGTCAAGCGTCGT
CACGGGTACCTGTTTGGGTCAACCCATGGGTCCGAGTAAATATAAAACCCGGGCGACTCGTCGAAACCGGGTCAAGAATAGTCTGGGTCATGGCACTTCA
GTTGATTCGTCACTGACATTCGTCATTTGCTAAAATTGAACCAATCGACGCCGTCTTTCCGTTGCAAAGATTTTGTTTCCTCCCCAAAAGGAATCGGCGA
GCAAGCAGCCCGCCCCCTCTTGCGCGCATTCATTCTCACGCTCTCTCGCTATCTCCCGGATCCCTCGCCGTTTCTGACCTGCGGTCGTGCTCTTCAGTCG
CAAGCGTACTGTCTTGCGCGTGTGCAGAGCCCTCAACGTCGCGCGTCGGGACGTTAACGGTCAAGAAAGGGGAACTTACTGAAGAGGATGCAAGAGGCAG
GCGCGACTGTCACGCCGCGCGCGCCGCCCAGCGACCATGAAAAGAAGCTCATGCATGTGATACTGCAGGCCCCAGACACGCGTGTGGCACCGCTGCTGGC
GTGCATCAAGGGCTGGCCCATGGAGGCGCAGGCGGACCTGGCCAACTGGCGCCGTGTACTGGAGAAGCTGCACCGATTGCTTCTGCTGGCACTGCAGCAG
TGTCCTGCACTGCTATTGGTCGAAACGGAGCTCGAGAAGACGGAGCTGCCAGCGACAACAACAAGTAGACAGACGGAGCGAGAGCTGACGGAGCAAATGC
TGGAAATCTTGAAGTTTTCCGGGTTTCTGCTGGAAAATGCGGCTAACAAAGCAGTATACCCATCAGCGGAGCCGGTCATGGCTCTCTTAGGTGCAAGGAA
CGAACGAGTGGTGACTGAAGCTATCAAAGTAGTGGCGATGCTGGCCGTGCCCCCTCAAGTGCATCGTTACGCTGCAGACCCCACAAGTTTTGTGGACCAT
GCAGCAGGAAAGAATAGTCTACTGCGACGTCGATTACTTACAGTGGCAAAAGGACGGGGGACGCCCAGCATTAGTCTGGAAGTGGTGGATTATCTCGATG
GGACGAACACAGAGCCATTGAATGACATGAAGTTTCAGTTTTATGCCCCAGAACAGCAAGGAAAAGATTTGACGTCCCGTGTGGTGAGTGTGGCTATCCC
ACCGTACGATGAAGTGATTACGGCTATGACATCTCCAGAAGACGTTGCGTATGCAGCGGCCACTGCATGCGAGCGCTTGATCGCACTGCATCAGATTCCA
AAGAAACTACATTTTCAGTTGTTCACACAGGTGCGCGCGTGTTATGCGTCGCGAAGTGCGATTGCCAGCGAGAATTCGGTGGTGGAACGATTGCACGCAC
TTCTAGCCCTTTTTTCGCTTTTCAGTGACGCTTGGGACGTGACACATTACGTCGAACAGCACCCAGAACTTACACGAGGGATTGTGGAGCTTATTCGCGT
CGAGAGTATTGAGCGCGTACCTGTGCGTATACGAGTTACGGCGTTGCTTGTGCTTACCGCGTTAGTGAACGATCGTGTTGGGAAAGCAGGTAGTATGGGT
ATGCTAGGACGTCAGTCGAATGTTCTGCAAGCTTTGGGAGTTGTGAAAGGGACACCACATGGTGTTTTCCCTTCGCTTGTGCGGTTTTGTATGGCCGAGC
TGAGCGATACCTCCGCAGTGGGTTTCGCGAAAGCCTCAGATTCTGCACCTCCCATTTTAATAGCGCAGGAAGCAGCTGATACCGACATGGATATGAGTCT
GGCTGTCGCATTTGTTCTAGCTACGACCGATTTGCTATCTCCACANNNNNNNNNNGGTGGATTCGTCGATTACTCTAGCGCTTCGCTCCTACGCATCTCA
GCAGCCTACTGACCTTCTTGGAGCTATCATAAAAGAACTGGGCTTACAGATGGACAGTCTGAAACGTGCGCGCGCAATGGTTGGGCTTTCATGGTCCCTG
AGCGAGAGCGGTGAAGGTGCCGAAAACGTGCTGAGCTCATTACCGGATTTGGATTTAGAGGAGCTGATTAGTACATGTGACGAGAGCGGTGCCACAAACT
CGGTGGCTGATACTGTTGTGGTAGTAGGCGAGTATCTCCGGGTTTTGGCGGTGCTGGAATGGCTTGCCTCCGTACTCATTTGGACGATGGAAACCGCACA
CACTCACATGCAGAGCCGAAGGTGGTTTACTGATTTTACAGCGTCAGCGACACAAAAAGTGATGGCGCGCCTGTTTTGCGTGGATCGCTCTGTTCAGTTT
GAGCGGGCAAGCCTGGCGGCACTATACCAGAAAAGCCAAAAAGAAAAAGGCAGCAAGGCACAGACGAGGCAGACTGATGGATTGAGCACTAGCGTGGAGG
TACCTGACAGATCCGGGTATGCTACATCAGAGTCCAATGTAGTAAAAAGTGGTGTTAGGGGCACAGGTCTGTGGAAAATGGGCTCTTTGCTACTCCTGCG
CTTTTCACTGAGCATGCGCAGTCTTTTGACGGCCTATAGTAAGGTTTTCTTATCGGCTCCGATGCAACATCGTCGAGGGATAACAATTGTGGTTCCCTTG
ACGCCCATGCTCGAGCCGCTAGCACGGACGTGCGCAAGTCTTAGAAAACATTTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGATTCTCTCTGCAACATGGAGATCTCAAGCCGTCATGTACGCCAATATTACTT
GCTTTTGACGCAGTGGTAGCTGGAATGGCGACCAGACGATTACCTTCTTCAGGCGCCTCGTCTGTTGATGCTGCTATTGTAAGGAGGGAGACCAATATTG
AGAATGAGTCGAAAGGACACAATGAGAATGATGACAGTGGCCGAAAGGAAGACTTGTCCTTTGAGAAGCAACTTGTCAAGATTTGCTTGCAAACACTGAA
GCGGGCATCGTCGGTGGTCTCGACGTATACCAGTAAGGTAGCAGCTCACGCCATTTGGCAGCTTTTGGCGCGTTTGACGCTCCAGTATGACTTGTCGTCG
TACTTTTCGTCACACGGTGGCCTTGATGCAGTGCTGGATATCCCGGAAAGTTTTCTGTTCGCTGGGTACCAAGAACTGACCTGCACGTTGCTCTCGCAGA
CACTAGAATCACCCGACGTCCTAGAGCACATGATGGAAGAAAAAATTCGGCGTGTCATCGCCAAGTTATCAACACGATTTGGTCCGCCAAGCCAGATGCG
TATCACTCTGCGTGCGCTATTGACAGAAGTTGCCCCATTTGCAACTCGTGACGAAAGTGTGTTCCTAAACGCATTGCAAAAGTCTGTGCGGATAAAGAAG
TCTGAGTCGGGTCGGGCATACGTCGTACCAAGAAGTATAAAGGCTGACGGTACTGACACATTCACAGGGCAGTCTTCTCGTTCTCTCCTGGATCCGAATA
GTGCGACAAGTGGAGCAAAGGCTTCGCACAAATTCCCTAAGGATCACAAACACGACGCTCACATAACTGTGCAAAAGATCATTGGTCGCATCCGTCGATT
GTGGGCCGTTGAAAAGCATGCCGAGCAAAAGCAAAATGCAGTGGGCAATGAGGTTGGAGCCACATCCGCAGGAGTGTGTGTGGGTATGTACTTGCAGCTA
CTGGTCCATCTGATCACCCATTTTCCTGCATGCGCGACAGTCCTGGCTAAAGGAAAAGATGAGGCTGGTCTGCATCGGGAGCGTGAAAGCTTCATACGTC
TTGTGCTGTGCGAATTCTTACCATCCCGCGAACTTTGCCAGTTTGTGGCAGCTCGAAATACTCTGAAAGAGGACGGATATTACGGAAACAGTAGACTGAG
CAGTTTTGACGTTGAGATGCTTGTTACCGATGTCAAAGAATTCATTGACCGACGTACAAGGTTGCGTGTGCAGTATGCGCACAGGCTATTGGTCAGCATC
GGCAGCCGTTCTGGCGAAGGTTCAAAGTGTATTATCTTACAGCTCGTCCATTTGCTTCAAGAGTGGCCGCAAAATGCTGGTGTTAACATTGCAGGCGGTA
ACTGTGACTTAACTGTAAGAGAAAGAACGAGCGTTGAGCTCTTTGCACGCGTGGTCGGGTCTGATCATGAGCATTTTATGGCCTAAGGGCTCTTCAAAAG
GATTTGCGTGGGACAAGGTCGTGTTAGGAGGAGGATTGAGGGGTAAACATGCTTTTGTGACTCTTATATCCAACGCGTTACGAAAGATTGACCTGACACA
CCCATTGGCACATGCTATTTGCACGATGTTGCTTCTCCCGTTATCGACACTGACGCGGTCGTTTGTGACACACCGTGTGCGGCGTTTACAAAAAAAGCGG
AATAATAGCTCGGCTGACTCGGGCAATGCGAGTTTGGCAGACCGTGATTCAAACCAGACGTACAATGACTCGGGCGTTGAAGTGTCTGTCGTAACAGCGT
TCGCGTCAGTTCCAGATTCGTCCATATCGGAGGAAGCTTGTGACACTTCAGAGTCGGGAAACCGGAATGTCAGGATGGAGGCAATAGAGACATCCGGACC
ACCGTATTCTGATGGGACCAGATTTTATCCGCTACGTGAAGAAGATGATGACGATGTTTCGATGCGATCTCCATTGTCGGAAACGGATGATCACGATATG
CACGACGACGATGATGAGCAGAGTGAAGATGACCGAAGCAGTGTGTCAGACCATTCTACGGACGAAGGAGAAGGTGAAGACGATGATGATGATGACGATG
ACGACGACGACGAGGAAGACGATGACGATGATGATGGGGAAGATGACGACGATGATGACGAAGACGAAGATGATGACGAAGATGATGAATATGATGATGA
CGAAGACGATTTTGTTGAGCACCAGCATCTGCTCATATCTCGCCACACCGGATCGAGCCGCCGCACATCTTCCAATCGTCTTTGGGCATCTCTTGAGTCG
GATTTATCGGTTCTAGATGAGATGGACGAGGTTGACGAAGATGAATACTCTTACTTGAACATACTCGATGACGAGGCGATCTTTGCTGAAGAACAACGAC
GACGCGCTCGTCTGATAGAAACACGAAACAGCAGACCGGGAAACAATGCTAGCGAAGAGAGCCAGCTAGCAGCTGACTCGGAGGACGGACTCGTTGAGAC
CATGCGCGATGCGCTTCTTTTGCACAACAGCAACGTTAGCGGATCAATTTCCACAACCAACGGCGAAACTCTCGTGCTGACATTTGGCGACGTAGAAGAC
GACGTAGAAGAAGCTCAAGCGGGTTTCGTTGTGCCAAGAAGTTCTGTGGGCAGCGGACGTGCGGTGGGACCTTCTTCAGGATTGGAAAGTCAATCGGGGG
GCAGCTCCGATAGTATGGCTACCTCGCTGCTCCAATATATTGAAGAGCTACCCGATATGCTAGGTGACGATTTCACTTTTGAAGCATTCGATGCAGGTGG
TAGAGGCGATCGATCACGTCGCGAACGTCATTCAGATCGTCCTGGTAACAATGTCTTCGATCAGCTTAATTCAGGTAACACAGCGACACATCCGCTGCTG
CGGTCGCACGGACGTGAAGACTCCATCTTGGTACGTAGCACCAGGCGACTGTCACTTCCCCGTCATTCGTCTCTTTTGCGAGAGCTACAAGAGCTGACTG
ATCAAGTTCAGTCACAGTTGCCGCCAGGCGGGAGCAGATTACGACTGGCTCTGGGACGGGACTTGTTGCAGCGCGGAGCAGGGGGAAATCGTGGTCGACT
ATCCAATCGTGGTAATCGTTTGTCTGCTGTTAGCAACCTGCTCAGTGAATTTTCGCTGGATATCCCGGCCTCGACACTGCCTTCTCGAGACCAGCATCTC
GGTTTACGAAGGGGTGACCGGGATGTGTTCAGTGATATTTTTGCCGGTGTTGGTTTGCCCCGGGGACTTAGCAGTCGTGCTAATGACGTGATTGGCGGTG
CAGCTAATTCGACTATATGGCGCTCAGGTGGTGAAGGTCGTGACATGGATGTCCGGTCGGTAGCTTCCAGGCTTGAACAACAAATTATTCGCATTTGCAT
CGATGAAGAGGGGCCCACGGCGACAGCTGCTGATCTGCAAGTAGAAGGTGGGACAACCACCCAGCCGCAAGATGGGGCTGACGATATCATGGAAAATCAT
AGTGCTGCTGGGACTCCGCGAAGTGAAGAGCACAGTGCAAGCGAGCTGCAGGCCCATGATGACGCTGGGGAGAGCCGAGCTGGACCGGATAACTTAGCCC
ATGCCGATCAAGCCGAGGTACACGACACAGCAACAGAAGCTGCTGTTGTTTTGGAGCTTACCAGTACTCTCGGAGAAACATCTCTGCTGCGATCACCAC