Description :
From Genome Similarity Track
Location :
Scaffold_21:9189- 11277
Sequence
2088 bases(100 bases per row)
ACGCGATTAACTGCTCAGTCTGACCATCGGTCTGCGGATGATCCGCTGTGGACATGTCCAATCGCGTGCCAAGCACCTTGACGATGGAAGTCCAACACTT
GCCGGTGAAGCGAGGGTCGCGATCAGAAATGATTGCCGGTGGCAACCCATGTTGACGAACACACGATCGATAAACAGCATCGCTATACCTTTGCCATAGA
TGGAATTCGGTACCGCCGCTAAGTGGGTCATCCCACTTAAATGGTCAACAAAGATCACAATTACCGTATTGCCGTCACAGTCTGTGGGAAGACGAAACAC
AAAATCCATACTTATGAACTCCCAACACCCCGTGGGCACAGGTACACTGGCGAGTGGTGCAGCCGAATGTACTGAGGGTTTGACCCGCTGGCACGTTTCG
CATGTACGCACGTATGTGCTCACCCATTTGTAGAGTTTGGTCCACCAATAGTGCTGACTCACAAAGCCATAGGTCTTTTCGCGGCCCAAATGCACACTGA
GGGCAGTATTGTGGGCCTCAAAGAGGATTCGATACTTTAATCCTCATCGTGAGGTACAACAATGCGAGCGGTATCCGCTACATCTATACGATAGCACAAG
CTCCCATTATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTGCCGATAATTGACTGTCCAAGTCTTTGTGTTCCTAACTCCCAAGGGAATGAAACA
ATGCCACACATTGAGAATCCCGCGGATATGCCACACGAATTAACTCCTCAATAGGAGACGACAAAGTCGTGACATGAGCAATCTCATAATCAGGTCTGCG
AGAGAGGGCATCTGTCAACACATTTTGTTTGCCTGGCTTATACTTCACCTCGAAGTTATATTCCGCAAAGAAGGAAATCTACCGATCCATTCTCTGAGAG
AGGTGAGGCGACTGTGTTGCCGTGCGTAATGACGCATGATCCGTATAGACGACGAATGGCTTGGAGCCATGCAGATGGAATCTAAATATAACGAGCGCAT
ACTTCATAGCAAGTATCTCTTTATCATGAACTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGATATTTAAATGCGATAACTCGCTCGTGGCCTGCAGC
ATCTGTTTGTAACAGGGCGCTGCATTTAGCAAAATTGGATGCATTGCAGACAACACTAAAAGGGTAATCAGGATTTGGCAACGCCAAAATGGGAGCATGG
AGGAGACTCTCCTTTATTGCCCGAAATGCGTCGGCATGGGTGTTGTCACAGCGCCAATCTGTGTATTTTTTAAGATGATCAGTTAATGGCCGAGCCATAT
CAGCGTAAATTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCACTACGCAAGTCCTTTTGATTCATAGGAATCGGCCAGTCCACTATAGCTTTG
ACCTTAGCGGGATCCACTCTAAGGCCGAGCTTACCAATGAAACATCCTAGAGAAGGAATCTCCTCTGCACCAAAAATGCATTTAGACGCGTTGGCGCACA
ATTTTTCAACATCTGACCGACCTTGTTTGGTACGACTATGGACAAAAATGTCATCAAATTACGTCTGTGCGTAATCCCTATGTGTGCGGAGAAGTTGCGT
CACCAGACGATTAAATGTTGTTGGAGCATTAGACAGCCCTTGGGGCATCACTAGCCATTCCCATAGCATACCACTCGGGATGCTCACTGCTGTAAGCGGA
ATATCACTCGCTCGCATGAGCAATTAATAATATCCATCGACCAAGTCAAGTGCGCTATACATAGTACAACCAACCATATTGTTTTGAAGAACATCCTTTC
GATGAATGGGTGTCTGCGCCGGTATATTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTGCCGTTCATCTTTTCGACACAAAATGTCGG
TGTCGAATGTGAAGATACACTCTCACGTACCATTACTGCCTCGTGCTTATCACGGAAGAAGTCATCAATGACATCACATTTCTCCTTAGGCAAGTGCCAC
TGTCGTGTGACACATTACTTAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTAAAGGTAAAACCGAGGGTGGGTCGT