Description :
From Genome Similarity Track
Location :
Scaffold_1052:9188- 10587
Transcript NameFunction/comments
Phyta_totarag11870hypothetical protein PHYSODRAFT_560159
Phyta_totarag11871conserved hypothetical protein

Sequence
1399 bases(100 bases per row)
GGGGGCTTCCTACGTCGACGAGAGCGCCATTGACCGTTAGTTGTTGCTACTGTGCTATTTGAATGGTTGTTGTGCAGTAGGAGTGACTGAGTGGTGGTTA
ATAACAGGTATGGCTGGAGATGTCAACTTGTTCTTCAACGACTATGACGACCCCCACGCGTGCGAGATGGAAATTATGATTGCAGAGGAGAAATACCGCC
GCAAGGGCTTCGCGGAGGAGGCAGTGAAGCTCATAATGGCTTACGGTATGAATGACactcttgttgctgctgtgaggGTATTGGCTTTGGAACTGACAGT
TTTTTTTTCGCGCGATAATCCTTGCCCCTGCAGCGACGTCTAAGCTTAATGTCACCCGATTCTTCTGCAAGATCATTGAGACGAACAGCGCTTCGCTTCA
GCTCTTCGATAAGTAAGTTGCGTGTTTGTTTGTTTCGCACTAATCCGTCGTCTGCTTTATCGTTTAACCCACTCTTGTTTGACTTTTCAACATGAAGACT
GGGGTATGTTAAGTACAATTACGTAGCCGCATTCAAGCAGGTAGAAATGGAGTTGGTCACCAAGGATAAGCATGCGGAGCTTGTCGATGCGGTACTCAAG
TCTGCTGTCATCCATCCGCCACAATAGATCTGGCAGCAGACAACTTCCTGCAAACAAAGATAGAGGACAAACACAAGAGACGCGATTACATCAACGAAAT
GGACATTCATGGACGATGGATTTTAAACTTCCGGTTGTAGGGCTTGTAGTTAACATCTACAGTGGTGCTGGCAGGTCAAAAGTAACAGTCCTGGCGTCTG
CAACTTACAGCAAGCACTCGAACCACTTCAAGGGCTTCTTCGCGCTACTGAAAAGACCTTCACCGTTGTGGAACGTCGTATCAGCATGATTCAGAGCGGC
GGCATACCATGTGGTCGAGTATGTGGTCTCGAACGATGACGAGTCCAAGCTTCCAATGCAGCTCTGGAACTCAACCTAAGGTTTATTACAACAAAAAGAG
CGCATGGTTgttagtacatgtacacgctGAAATTCCAGAGGAGCAAGCCAGTAAAACTTACAATGCCGTCGTTCTTGGACGAGTGGTGCGGAATGAGCAA
ACCTCCCGCCAGCAGTCCCGCGTACTCGCTGGAAAGTAAGCCCGAATACGTCGTGCCACACATGCTGGCAGTCACGTACTTCTCATGGATAGCTCGTGCG
GCTGCATAACGAGCTGAACACTCGTCATCGCAATAGTCCCCGCCATCATACACGAGTGACCGACGAGTGGTGGTACCAGGACACTGACCAATAATTCCAC
CGAGCCCAGCCAAAATATTCTGAAACACGTTGCCGCCGTCGCAGATTTCATGAAGGAAGTCAGAGCCCATGCTGCCCTTCATCGGACCGCTCAGATCCA