Description :
From Genome Similarity Track
Location :
contig_21:91872- 93694
Transcript NameFunction/comments
g4766.t1hypothetical protein

Sequence
1822 bases(100 bases per row)
GACGGCGGAAGACACGGTCCTGCCGCTAAGCGTCTACCTTTTCCTCACGTCCAACCTCAACATGGAAGACACCCAAACACTCTCGGCACGCGCGCTACTG
GGACAGCCGTGGGCGCTCAAGCGATCTTCGCGTTGTTCGTCCGCTGCCAAGAACTGGAACAAAAAGTTTGGGTCATGCTTTTCCCCCAAATATCCCGCCG
ACTCAGTTGGTTTATTTGGGAGGTAGACATCCGAACCGTACTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGATATCATCCACTGAAGCAC
CCATGCTCTAAACCCACCACATCACTGGGTACCGGACTACGCTACTCCTAAGGCGTCAAATGTCTTTTATCGCTGTAAGGTAGCAGAAAGCTTGGAGTTC
CTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGTGGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATCGTGCTGTGCTTCATGGAT
GCCTGGGTCATGGCATCCAATGCGGCCTCAAAATTACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATTGTACACCTTGCCAGTCTC
CACATGTAGCTCCGCGACACAAGGTCTCCGGCACCGCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGATAGGAAGCCAAAATGTGAC
AGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGAAAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACCAACAAAGTGCATGTATTT
AATACATGCTAGCTACATGAAGTCAGGTGTCGCGCGACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACATGCAGACAGCCATCCTTCG
GAGCCAGACGGCTCGTTTCTGGTCGATGAATCACTGGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAGACGGAGCGCCGACGTCGA
TCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAGGCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAATACGGACAGATTCAAGCA
GGACCGTGCCCCTGTCATACATTTCGCAAGGCTAACCTTGCACCGGTATCGTCTAGAGACGAACGTAGACCGAGGCCTGGCCCGTGCGTGCGTGTTGCGC
TGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTCTCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTCGCAAGTTACCACCAAGGC
CCAAAGCCGAAATGGGAGTGCAACCTGAAGTCTTGCCACTTCGTGTTCAGCGATCACAGCCGCGGCCCGCCAAGTCCCCGCGAGGTCTCTCAAAGCGGCC
GAGTTTCCGCCGCTCCAAGTCCCTACCCATTGAACTCCCAGAAGACGTCCGCCTGCTCAAGCAGAAGATCCTCGATACACACCCGGCCAAGCTGACGCGC
TTCAGTCTGAGCCACATGCGTCACAAGGCTATCCCACCCGTACTCATCCCAGACACCCTGAGCGACCGACGAGCCATGCGAACGCTCGTCTCCGGCAAGA
CCGTGCCGCTCACCATGCACATGTGGGATAACTGCAAGAGGAAGACCAAGCACCTGGATATGATCGACGAGTACGTCACCTACCGGTGATAGCTCCTCCA
CCCGCATCAGTTCTAGCTAGTCCCCTCGCCTCTCCCTTGAACTACAGTGCCGAGAAATCTCAGTTACCACGCCATTAGTGTGTGCTAGGTAGCCTAAGCA
TGAACGCGATGCAACCGGAGTG