Description :
From Genome Similarity Track
Location :
contig_21:91869- 93689
Transcript NameFunction/comments
g4546.t1hypothetical protein

Sequence
1820 bases(100 bases per row)
CGGTCCTGACGCTAAGCGTCTACCTTTTCCTCACGTCCAACCTCAACATGGAAGACACCCAAACACTCTCGGCACGCGCGCTACTGGGACAGCCGTGGGC
GCTCAAGCGATCTTCGCGTTGTTCGTCCGCTGCCAAGAACTGGAACAAAACGTTTGGGTCATGCTTTTCCCCCAAATATCCCGCCGACTCAGTTGGTTTA
TTTGGGAGGTAGACATCCGAACCGTACTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGATATCATCCACTGAAGCACCCATGCTCTAAACC
CACCACATCACTGGGTACCGGACTACGCTACTCCTAAGGCGTCAAATCTCTTTTATCGCTGTAAGGTAGCAGAAAGCTTGGAGTTCCTGTCGATGCAATT
GCATTGGGCTCAGCGTTTGGTGGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATCGTGCTGTGCTTCATGGATGCCTGGGTCATGGC
ATCCAATGCGGCCTCAAAATTACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATTGTACACCTTGCCAGTCTCCACATGTAGCTCCG
CGACACAAGGTCTCCGGCACCGCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGATAGGAAGCCAAAATGTGACAGTCGAAAATGCGA
CGAGTCGAAGGTGTACCGCGAAAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACCAACAAAGTGCATGTATTTAATACATGCTAGCT
ACATGAAGTCAGGTGTCGCGCGACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACATGCAGACAGCCATCCTTCGGAGCCAGACGGCTC
GTTTCTGGTCGATGAATCACTGGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAGACGGAGCGCCGACGTCGATCGCCGTCCAAGCA
GCTTCAGAAATGCAAGGACAGGCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAATACGGACAGATTCAAGCAGGACCGTGCCCCTG
TCATACATTTCGCAAGGCTAACTTTGCACCGGTATCGTCTAGAGATGAACGTAGACCGAGGCCTGGCCCGTGCGTGCGTGTTGCGCTGAGCTAAGCCAGC
CACTCAGCTGGTTCGGCCGTCTCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTCGCAAGTTACCACCAAGGCCCAAAGCCGAAATG
GGAGTGCAACCTGAAGTCTTGCCACTTCGTGTTCAGCGATCACAGCCGCGGCCCGCCAAGTCCCCGCGAGGTCTCTCAAAGCGGCCGAGTTTCCGCCGCT
CCAAGTCCCTACCCATTGAACTCCCAGAAGACGTCCGCCTGCTCAAGCAGAAGATCCTCGATACACACCCGGCCAAGCTGACGCGCTTCAGTCTGAGCCA
CATGCGCCACAAGGCTATCCCACCCGTACTCATCCCAGACACCCTGAGCGACCGACGAGCCATGCGAACGCTCGTCTCCGGCAAGACCGTGCCGCTCACC
ATGCACATGTGGGATAACTGCAAGAGGAAGACCAAGCACCTGGATATGATCGACGAGTACGTCACCTACCGGTGATAGCTCCTCCACCCGCATCAGTTCT
AGCTAGTCCCCTCGCCTCTCCCTTGAACTACAGTGCCGAGAAATCTCAGTTACCACGCCATTAGTGTGTGCTAGGTAGCCTAAGCATGAACGCGATGCAA
CCGGAGTGTCGTACAATATT