Description :
From Genome Similarity Track
Location :
contig_109:91864- 93065
Transcript NameFunction/comments
g13688.t1hypothetical protein
g13689.t1hypothetical protein

Sequence
1201 bases(100 bases per row)
CGAGTTCGAATACTGCCGAAGGACGCTCGCCATCATCTGCATCAAGTCAGCTTGGGGTGGGGCTGGAACAGCCGGCGGAGCAGCGGCCCTCTGAGGGGTC
TGATCCTCCAGTGCGCCCACGCGGGCATAGAGCTGTCGGATCCAGTGAAGATGATCCCGAAGGGCACCGCGGTCCTCCTGAAGGGCTCGTTCGCTCTCCG
AGCAGCGGTGAGCGACCTGACGAAGCTCCTGCTCGAGGCCATCAACCCGCTGTTGCAGATCATGCGCTCCGCGCTCGAGACGACCTAAATCGTGAGGGAC
GTCCCGTCTTGACTCAACAGTCGACTCGACAAGATGCACGCGACCGCGTAGGGACACAAGATCCGTCCGTTGCATCTCCAGCAGCCTCTGGCAGCCCTCC
ACAGCAGTCAGGAGGCTCCCCCGGCCGACGAGACGTCTTTCGCCGAGGTGTACGACACGACGAGTGACGCGAGGCGTCCTGGTCCGTCGACACGTCCGTG
GCGTCCCCCGCCCCCACTGATTGGTAATGAGGGCGCTCTCTACTATCATGTCGAGAGGATACTGAAGCGCCGCGGGCGTATCGGTCACTACCAGTATCTG
GTGAAGTGGCGCGGTTATCCAGAGGATCAAAACACGTGGGAGTCTGGAAGCCGCCTCTCGGAGGACTGCGCCGACCTCGTGGACGCTTATGAGCGTTCCC
ACGGAGCCGGTCGGCGTTAACCCGGCCAAGAACACTTCGAGGTTCTATCGGCTGGGACTGCCAGGACTTCTGGACCTTCTGAAGGACCTCCTCGAGGATG
ACCCCCGGGGTGGGCAGGTTGCGGTCGAAGCTGCGGGTGCGCCACTGGCCGTCGACGACCATCTTCGCCATACGAAACCGAAGACGTCGCTGGGCGAGCC
AATCGAGGCGATACGGAGAATCCGGAAACTCAGGCATGGGATATCCCAAGTGGCGGAGCCACTGCGTGAACTCAAGTTCGTTGGATTGACGGGCCAGGCC
CGTGTCGTCGTACAAGACGACCGGACACTCGTCGTAGTGCGGCAACCTGTGCCCGGGTTCCCGACTCCGCCGGAGATACTCGCTGTAGTCTCGGAAGGAC
CAGTATCGCAATGCGAGAAGTTGCTCTCGCGTTCGAGGAGTCGCAGACTCGTGATCGCGCTTCGAGTCTCGGCGCTGCTCGATGGCGACCTTCACATCTC
G