Description :
From Genome Similarity Track
Location :
Scaffold_2:918477- 920831
Transcript NameFunction/comments
g1583.t1RAW42868.1 hypothetical protein PC110_g930 [Phytophthora cactorum

Sequence
2354 bases(100 bases per row)
TGGAGGCAAATACTACATCAACACGGCGGGCAAAAAAGTGTACGTGAAGTAAGAACTCTTCTTCCTACGCGGCAAGCACCCGGCTGGTGCCTAAATGCGC
GGTGGAAAATGCAACCGCGTCGCAATAACAAGAATTTGACTAAAATAGCTAAAACGGAGCGATATTTTAGCTGCAAAACACAATACATGTATAACTAAAT
GAATGGTTGTGCGCGGAAGCGGGTGGGAATCTGGCAGCCGCGGGATTCGTGTCGTCCTCGACTGTCTTGTCCTCGCCATCGACACCCTCGAGGCGCGCGG
ACAGGTAGACCGTGCCGATGACACGGGAAAGTTGCTACTGGATTTAATTAAAACCATCGTCAATGCCGATGGTCCGCACGCTCTGTCCAGTGATGCAGTA
CTTCTCTAACTCAGCGCTGGGGTACAATACGACAGCTCCACGTTCAGACCTCAACGTGTGACCGTTGAGTATGGCAGAGACGGACGCCACAGCAACTTGC
ACGACCACACAGATTTACAGAGTGGTGCCTGGTCGTCTATAAAGCGACAAACAATACTTGAACGTATGAAGTTACCTACCGGATTCCATGCATTTCCTGC
AACCACGGAATTCGTGCAGCAGTGGGTGTAAAAACTAAAATCCAACCAATAATATTAAATGACACCCCTTCTTCCGACCAACCTCCATCCTATAACTAAG
TGGTGAAATAAAACTTTATTTCTTGCATTTACCGTTAGCAGCAAGTTGGGGAGGGGGGGGGGGGGGGGGGGCTGGGAATGGCAAAGTGACCATCATGGGT
ACGCAGCCCGATGGGAACTAAACCAGCCTTCATGAAACCTCTGCGAATCGTTATGTCTAATATGTTCTCCCATGCATGCAATACGATCGATGTAATTAGG
CTACGTCGTGCTTGAGGGGTTACACTGTGATCATGAACGCAATGATGCTGAGCATATAGCTCGCGGCACTCACGCTTAAAACCTGCCATAACAGCGACGT
CCATTGGCTGGGCAAACATCGTAGCACCGGGAGGGACGAGCTCCACGTCGGTCATTGCGTCCTCAAGATGAGCACTGTGCGTGCTCATCTTGTGCACTTT
CAAGCTGTCACGCTCTAGCGTGCGACAATAAGAAATCGATGGCATCCAGACCTACCGTAAGAGAAAATGTCATTAATAAAACTAGAAAAAATATCACGAA
CGCCTTTCTTAACATGAAGCGTTCGTCGCAATATGCTTTCTTCTGCACTGCCAGTACGACCTTCTCCTCCTTGTGCAATATATTTTGGTGTACTTCAGCT
TCGACTTTGCATCCCTTTGCTCCAGAAAAAACGATGAATGGGGGTAATTTAACGCCAGTAGCCGACTCACACAAAAACACACTTGTACGGAACGAATTTT
CAGACATTCCTGCAAAACAAATTAATTAAAAGCACAATTTTTAATATCAACAATACACATACCTTGAACCACATCGACATCACGTTCCCCTTGAAAGGTG
ATTGTCGTCTTGGGGTTCATGTCGATGTAGATAGAGGTTTGGTCCATGTTAAAAAGATGCTCGTATTTGTCGCACCCCTCTAGGACGGGGGTGGTTTCAA
TCTTATACCGCATAGCGTGCCCAAACTCGTCTGCTACAATCTATAAACCACAATTTATAAAAATTGAATACTCGTGTGTTAAATAATTGTCAATATCAAT
AATTACCTGCACTTTCGACCGCTTCCGATGACCCTTGTGCGTGGTCCTGCGAATCGAGAGGCGATTTCGCAGACAAAAGCGTCGAAGATATTTGACAGAG
GCGGCCTCGGAACGCCCCTCAAGAAACTTCGGCTCGAGCTTGATGCTCATCATGAGCAGGCACCGCGTCGTGGCGGCGCGGACCTTATTGCGACGCATAT
CCTCGACTCATTCAAGCAGCCTAGTTTTCCAACGAACAACGCAGATAATTACAATTAATAAATAAAATACACAGCAGAAACAGATAAACTTACCGCTGCT
CGAGGGCAGGGAACCTGGTTTTTGGTCCATGGCGACATGACTTCAGCACTGTCCTGCTAGAAGCAGCCGCAGCTATCTCGTCACGCCTCTGGTCTGCGCT
AGCGCACTGGAAACACCGGTTGCGATAGCGGCGTCGGCTGGCTCCGAGCGGTGACCGTTCGTGTAGAGTGCTTCGCGCATGATGCGCACGACAGTTAGTT
GTTAAGTGAACTTAGTCGGCAGCCACTCATTGTTGGAGCCATGTTTAGCACTTTTTACCATAGTTGACTTTTTACATTGCTCATAAATCAATTTTTACAT
CGGTTGCAGGAAATGCATGGAATCCGATACCTTACAGAGAGAAGTTGACTTGTA