Description :
From Genome Similarity Track
Location :
Scaffold_151:91831- 94163
Transcript NameFunction/comments
Physo_14378270 kDa heat shock protein

Sequence
2332 bases(100 bases per row)
CGCGCGCTTAGAAGCGCACCATGCGCTCGAGCATGCGCTTCTTGTCCTCGAGCTCGCGGAGCGTGGCCTCCTCGTGGTCCTCGAGCCAGTCGCGGGCGTC
GCGGATGGCGCTCTCGACGTTGGTGTCGCCCTTCTCGCGGGCCATCTCGATGGCGCGGTAGATGAACTGCTCCAGGTCGTTGCGGGCCTCAATGCGGCGC
AGCATCTCGGCGTCGTCCTTCTTGAACTTGTCGGCCTCGGCGACCATGCGGTCGATGTCCTCCTGGCTCAGACGGCCGCGGTTGTTGGAGATGGTGGTCT
CGGCCTTGGCGCCCGTCTTCTTGTCGCGGGCGGACACGTTCAGGATGCCGTTGGCGTCGATCTCGAACGTCACCTCGACCTGCGGCTCGCCGCGCTTGGC
GCGCTCCAGGCCCGAGATGTTGAACTCGCCCAGCTTGTTGTTGGACTCCACGCAAGCGCGCTCGCCCTCGTAGATGCACACGTCCACGGACGTCTGGTAG
TCCTCCTCCGTGGTGTACACGCGCGTCTTGCGCACGGGGATGGCCGTGTTACGCTTGATGAGCACCGACATGACCTTGCCCACGGTCTCAATGCCGAGCG
ACAGCGGGGTCACGTCCACCAGCAGCAGCGAGTTGGTGGCGTCGTTGCGGATGCCGTCCAGGATGGCGCCCTGCACGGCGGCACCGTAGGCGACGGCCTC
GTCCGGGTTGATCGACTTGGACAGCTCCTTGCCGCCGAACAGCGTCGACAGCATGGTCTGCACCTTGGGGATACGCGTGGAGCCGCCCACCAGCACCAGC
TCCGTCACATCCTCGGGCTTCATCTTGGCGTCCTCGAGCACCTTCAGGACGGTCTCCTCGCAGCGCTTGAACAGCTCCTCGTTGAGCGACTCGAACTTGG
CACGGGTCACGGTCGACGAGAAGTCAACGCCCTCGAAGAGCGAGTCCACCTCCACCGAGGCGCTCGTCGTGGTCGACAGCATGCGCTTGGCCGACTCACA
GGCCGTGCGCAGACGGCGCATGGCGCGGGCCGAGCCAGACGGGTCCAGGTTGCGGTTCTTGCGCTTGAACTCCGTCAGCAAGTGCTCCACCATGTTGTTG
TCGAAGTCCTCGCCACCCAGGTGCGTGTCACCGCCCGTGGACTTGACCTCGAAGATGCCGTTCTCGATCGACAGGATCGACACATCGAAGGTACCGCCAC
CCAGGTCGAAGATGAGCACGTTGCAGGCCTTGCCGTCCGTGCCGGCGTTCGTGTCCAGGCCGTAGGCGAGGGCAGCGGCCGTGGGCTCGTTGATGATACG
CTTGACGTCCAGGCCAGCGATCGAACCGGCGTCCTTGGTCGACTGACGCTGCTGGTCGTTGAAGTAGGCGGGCACAGTGACCACAGCCTGGCTGATGCTC
TGGCCCAGGAAGGCCTCGGCGGTCTCCTTCATGCGCAGCAGCACCATGGACGAGATCTCCTCGGGGGTGAAGCTCTTGTTCTCGCCCTTGAACTCGACCT
CGATGAGGACCTTGTCGTCGTCGCCTTCCTTGATCGTGAAAGGGAAGTGCGTGGCGTCCTTCTTGACGACCTCGTCGCTGAAGCTGCGGCCGATGATACG
CTTGGCGTCGAACACCGTGTTGGTGGCGTTACCGGCGGCCTGGATCTTGGCGGCCTCACCGATGAGACGCTCGCTCTCGTTGAAGGCGACCCACGAGGGC
GTGGTGCGGTTACCCTCGCTGTTGGCGATGATCTCGACCTGGCCGTCCTTCCAGACGCCCACGCACGAGTAGGTCGTGCCCAGGTCAATGCCGATGACCT
CCGAGAAGCCCTTCTCGGCGCGTTTGGCGCGCTCCTCGCGCTCCTTGCGGGCCTTGTTGATCTTCTCCTCGATCTCCATGCGCTTCATCTTGCGCGTGGC
CTCGTCCATCTCGACGCCGCTGATCTCCTCGTCCTGCACCTGCTGGGCGGCCTGGGCCTGAGTGAGGCCGGCCTGCAGGGCCTTGTTGCCCTTCTCCACG
GTCAGACCCTGGGTGTACGCAGTGATGGCCTTGGCGTAGTTCTTGATGTAGAAGTGGGCGGCACCGAGACGAGCGTAACCCTTGGCGAACTTGGCGTCAA
TGTCAATGCACGTCTTCGCGTCCTGCATGGCGGGGGTCGCCTGGCCAGCCGACAGGTAGGCGGCCGAACGGTTCGAGTAATAGATGACGTTCGTGGGCTC
GTAGGCGATGGCCGTCGTGAACTCCTTGATGGCCGTGGCGTGGTCGCCCGAGGCAAAGGCGGCGTTACCGCGCTCCTTGGCCTCCGCGCCGAGCTTGGCG
CGCTCCTCCGGGGCAACACCGGCGTACACGTC