Description :
From Genome Similarity Track
Location :
Scaffold_997:9183- 10422
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_997-abinit-gene-0.7DUF895 domain membrane protein
Pytul_var.sporangiiferummaker-pug3_contig_997-snap-gene-0.2Gene of unknown function

Sequence
1239 bases(100 bases per row)
GCACAGAGGATCCCAACGTTACAGAGAACGACGTTGACCTGCAGCTGCGTCAATGGAGCTACTTGAACCGCGCCAAGATACCACGCAACAGCAGCACTCA
CAGCTTGAACGCACTTGTACATGCCAGCGTAGCAGCTGCACGTGATCGCATCGTTCGCAGTGTGCATGCTCATGAACCAGTAGATCCACACTTGACAGAG
AGCGTCGTGGAAACCGTAGACAACATAGAGCGTGAGCAGCAGCACGAACAACGACTCAGTCGTATCCTGGGACCAGAAATCCACATTCAAGCTCGTCTCG
TAGCTCAGGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACATGACGTTCGCGAGCACGCAAAACACCAGCAGAAACTGC
TTTGAAACTCGCGCAACAGTGCCGTAAGTGCTGCACTGTGCTTCGCTCTGGTTGTCAGTATTGACGCATTCAGGCTGCGACCGCTGCTTCTGGATCTGAT
GGTCGAGAACGCGGCCGGACACGTACGCACCGCCCATCTGTGCCAACCAGTAGCTTGCACTCGCAAGGCCACTTGTGCGCGCATTGAACACGGCGACGTT
GAAGAACGCGTGGTACGTGTAGAACCAGTTGCTGTACACGAACAGTGGGAGCAGACAGAGCAGTACGTTGCGGTGCGATTGATCGCAAACAACGACGCTC
CAGGCTGTGTGCAGCTGCGCCCGCCACTGCATCCAGGACGCCGCCACAGCGGACGCACCTCTACTCGAAGGTTGTGCTTTGTCATCACCACCACTGTCAT
AGATCACATTGCCCGCGTCCTCGATGAAGCACACCGCGAGCGCAACACCGACGCCCATGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCAGGAACACAACAAACATGCCCGTGGACGCGCGCGTCACCTTTGCTGCCGTACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATG
ACCCAAAAGCGGCTCACGCTCTGGCCGCGTGTCTCGACGTTCGGGTAACTCATGATCATGAGCCCCTGCGCCGTCCAGAGGAAGCCCGCAGACACCCCCA
CCGCAACGCACGCGGCCATGAACGCGACGAGCGGCGCGAACCCGTCGACTTGCATGTTGAACAGCGCCGCCGCGTACACAAAGTAGCCCGAAGCGCCGAT
GACGAGCGCCGCGCGCACACCCATGGCCGGCACGAGCGC