Description :
From Genome Similarity Track
Location :
Scaffold_19:9182- 10604
Transcript NameFunction/comments
g11785.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g11786.t1hypothetical protein

Sequence
1422 bases(100 bases per row)
CGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATC
CGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGG
AAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGGCAGGGAAGACGGGGCTTG
GGCTCATAACCAAAAGGCTTGGTCGCTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGG
ATTCTCTACTGGATACACTCTACTGGATTTCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCCACAATC
TTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGTGTCCCGTCAACACAGGAATGATTGC
GGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGACAGCTGCCCGAGGCGCCTTCTTGACAATATGTACCCATGTCTATTGAGGGTATGG
AGGGTATGGAGGGTTACCGGTTTGGTATCGGTTGTTTACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGAT
TACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCA
GTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCC
TCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCCAAGATCCATACCTTCCATCAGG
TTATGAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACAT
GCGTGGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCG
AGCAACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGA
AGACGCTGTACGGTGGTTCGCA