Description :
From Genome Similarity Track
Location :
Scaffold_265:91726- 93575
Transcript NameFunction/comments
Aphin_H310_08862PREDICTED: protein C8orf37 homolog
Aphin_H310_08863glycylpeptide Ntetradecanoyltransferase 2 putative

Sequence
1849 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTGGTCGTGACACTTGCCCACTTGCACTGGCACGCGTACGCAACCGTGCCTTTGTCGCGCCATGAGATGACGGTGGCCGTGGCCGGCGAAC
TCACCCTGGCACGACTCCATCTTGCGTCGCAGCTTTGCTTCGTTCGGGACATTCTCGCGAAAGAACATGTAGTCGGCCGAGTCGCTCCATCTCCTGCGCA
TGTTCCCGTTATGCTCGATTCCGGCGGCGACGCCTTACGAGTGTTCAAACTGGACAACGAGGAAGTCACAGTCAGTGCACCGCAGGTTGGAGCATGCTCT
AGCACGACCACCGTGAGTTGGATGTTTGGCATCGCAGCGGTGCGCACTGTGGGTTCACCGAGCTCGTGGCCACACCATGCTTCATTTGAGACCCTCCCAG
GTACACGGCAATGCACCTGCTGCGACCGTAGATCACGCGACGCATGATCGTTGACGGCGCACCTTTTCGACGAGCCCGATGCGCCGACCGGTCTGTGCGA
AGAAGCCATGGCTGGCGGGGCGGTGCTTCGAACGTCCGTTGCGGTTGATTTGGCCGTGTCCGGGCCATCCACGAGGTCGAGCAGCTCGTCCAAGTCCGAC
TTGGCGTGGTGGGATGGCAATGTCTTGGCATACGAGTACGTTGACGACGCGGGTTTGTCCAAGCGCCTACCAGCCATCCATTCACAAACGCACGTGGCGC
TATCGAGATCGTACGACAGAATCGTGTGGCGCTGGTGCGATTTGGTCGCTTGCGGCGTATCATGGACCGCAGATTCGACTTCGTTCACCAACGCTTCAAA
GTCCATGGCCCCGACGACTTTCCAAGTTTGCACGCTTGAGCCTCTCTCTATTAATAGCGGCGACGGCGCCGTTTCGCGCCCCAAGACGATCATGTGGACG
ACGGGACATCCACTCGCATTCCTCGTTGTTGTCCAGGTTACAACTTGCATCGTCCTTGCACATTCGGCGACGACAACGTCCCCCTGCACTACGCAACTGC
TTCTACCTACTGCAATACGAGGCCGACTTTGTCGTGGGGCATGCGGGGGCAGCGCCAGTTGTACAGGTAGTACTGAAGTTCGCCGCTGCCCATGCCAAAC
TTGAGTTCGTCCAAAAACTCGGAATTTTCCATCAAGTTGAGCGCGTTGAACACGTCCATGTTGGCGGCCTTGGCCATGATGAGGCAGTTCTGCATGAGGT
CCGTTAACGACACGGACGTCGCAACGTTGTAGAACGAGTACGCAGCGAACAGCGTCTTGTGCGTCGCATTCCCAATGATCGTGCTCGGCAAGTGGTAGAA
CGAACAAAAGTCGGTCACCTTGTGCGACTCTGAGTTCTCGACGACGTACGTATTCACGACGCCGTCGCGCGGCAGCAGCCAGTGCGCGACTTCGTGCTCG
TTCATGTCGGCCTTCAAGTGAAACTTCTTTTGGTACCGACGGAGGAGCCCGGTCACGCAAGACACGTGCTTGGGCTGCATCGGGATAAAGTTGGCCAGCG
TCGGCTCTTCGGGCACCTTGTACATTTTGATCGTGCGCGTCATCGTCATGTTGGGCGGGAGGTGGGAAAACCCGACTTCAATGCACTTTTTCGGGTTCAA
GTTGCGATGGTAGTATCGGCAGGTCGAGACGGGCATCGGGAGCACGACG