Description :
From Genome Similarity Track
Location :
contig_109:91709- 92910
Transcript NameFunction/comments
g11186.t1reverse transcriptase

Sequence
1201 bases(100 bases per row)
GGCAGACGACTCTGAGAGTCCGACGAGTTCGAATACTGCCGAAGGACGCTCGCCATCATCTGCATCAAGTCAGCTTGGGGTGGGGCTGGAACAGCCGGCG
GAGCAGCGGCCCTCTGAGGGGTCTGATCCTCCAGTGCGCCCACGCGGGCATAGAGCTGTCGGATCCAGTGAAGATGATCCCGAAGGGCACCGCGGTCCTC
CTGAAGGGCTCGTTCGCTCTCCGAGCAGCGGTGAGCGACCTGACGAAGCTCCTGCTCGAGGCCATCAACCCGCTGTTGCAGATCATGCGCTCCGCGCTCG
AGACGACCTAAATCGTGAGGGACGTCCCGTCTTGACTCAACAGTCGACTCGACAAGATGCACGCGACCGCGTAGGGACACAAGATCCGTCCGTTGCATCT
CCAGCAGCCTCTGGCAGCCCTCCACAGCAGTCAGGAGGCTCCCCCGGCCGACGAGACGTCTTTCGCCGAGGTGTACGACACGACGAGTGACGCGAGGCGT
CCTGGTCCGTCGACACGTCCGTGGCGTCCCCCGCCCCCACTGATTGGTAATGAGGGCGCTCTCTACTATCATGTCGAGAGGATACTGAAGCGCCGCGGGC
GTATCGGTCACTACCAGTATCTGGTGAAGTGGCGCGGTTATCCAGAGGATCAAAACACGTGGGAGTCTGGAAGCCGCCTCTCGGAGGACTGCGCCGACCT
CGTGGACGCTTATGAGCGTTCCCACGGAGCCGGTCGGCGTTAACCCGGCCAAGAACACTTCGAGGTTCTATCGGCTGGGACTGCCAGGACTTCTGGACCT
TCTGAAGGACCTCCTCGAGGATGACCCCCGGGGTGGGCAGGTTGCGGTCGAAGCTGCGGGTGCGCCACTGGCCGTCGACGACCATCTTCGCCATACGAAA
CCGAAGACGTCGCTGGGCGAGCCAATCGAGGCGATACGGAGAATCCGGAAACTCAGGCATGGGATATCCCAAGTGGCGGAGCCACTGCGTGAACTCAAGT
TCGTTGGATTGACGGGCCAGGCCCGTGTCGTCGTACAAGACGACCGGACACTCGTCGTAGTGCGGCAACCTGTGCCCGGGTTCCCGACTCCGCCGGAGAT
ACTCGCTGTAGTCTCGGAAGGACCAGTATCGCAATGCGAGAAGTTGCTCTCGCGTTCGAGGAGTCGCAGACTCGTGATCGCGCTTCGAGTCTCGGCGCTG
C