Description :
From Genome Similarity Track
Location :
Scaffold_1:917056- 921314
Transcript NameFunction/comments
Sapdi_VS20SDRG_00301hypothetical protein

Sequence
4258 bases(100 bases per row)
TGGCGGTCTCGTGCTGCCGCTTCCGATATCGGCGTACACGGCGTCGCCCTTCTTTGCGACGGCCGGCGACTTTTTCTCGTTTGTGTTTGTGGTCTCGTAC
GTCCAGCTCGTGACGGGGCTCTTGGTCGCGCTCGTCAAGGAGAAGGAAACCAGAGCCCGCGAGATGATGAAGGTGCTCGGTGTCACCGACGGTGCGATCG
TCGGGTCGTGGATGCTCACGTACGGGATCGTTGTCCTCGTCGTTGCCGCGCTGCAGACGATTGCATCGAGCCAACTGCTCTTCCCCCACACGTCGCCACT
GCTCTTGTACCTCTTTTTCGCGCTCTTTGGCTTCGCCGTCGTCGCGTTTGGCTTCTTCATGAGCACGTTTTTTTCGAGGCCGCGCACCGGCGCCTTCCTC
GGGCTCGTGGTGTTCCTCCTCCTCTTCCTGCTTGGCCAAGCCTTCTCCACATCGGCGTCCGAAGGCGCAAAGGCGCTCGGGTGCCTCGCACCGCCGGTCG
CCATGTCGTTTGGCATCTCGGCGCTGGCCCGCGCCGAGGTCAACGGCGGCGGCATCACATGGCACTCGGCGCATCTCCTCGACAGCCACAACATTCGCTT
CGACACGGCGCTGTACATGCTCGCACTTGACACGCTCCTCTTGACGCTTGTCGGGTTCTACTTTGAAAAGGTCATTCCCAAGGATTACGGCGTGCCCGAA
CACTGGACGTTCCCGCTGCAATGGCTCTACCGATCCCGCGGGGTCTCTTCCTCAGCGACATCGCGAATGTCGGCACGGCTCTTGGCACAACACGAGCCGC
CACCACACCCGTATGTCGAAGCTGTCACGGACGACCTCAAACAGCAAGAGCGGACCGGCGACGCGCTGCAGATCCAGTGCCTTCGCAAGGCATTTCTCGG
TGACGACAAGATCGAAAAGGTGGCGGTCCACGGCCTCCAGCTCACCTTGTACAAGAACCAAATCACGTGTCTCCTCGGGCACAACGGCGCGGGCAAAACC
ACATTGCTCTCGATGCTCACGGGCATGCTGCCGCCGACCAGCGGTGACGCGACGCTGCTGCGCGGTCTCTCGCTGCGAAGCGACATGCATGCCATCCGCC
AATCGATTGGCATGTGCCCGCAGCACGATGTCCTCTACGACGAGCTCAGCGTCTACGAGCACCTAGCGTTTTACGGCCGGATCAAGGGCTGCGACGAAGC
CGAGCTCGACCAGAAGCTCCGGGCCGTTGGCTTGACTGAGAAGCGCCACACACCGAGCAAGGCCCTTTCGGGGGGCATGAAGCGCAAGCTCTCGCTCGCG
ATTGCCTTCCTCGGCGACAGCCAGATTGTGTTTTTGGACGAGCCGACGTCCGGCATGGACCCGTACAGTCGTCGGCATATGTGGTACACTTGACTTGCTA
TCTCGATGCATTGAAAGATTGATACTCATGGTGCCTGTGCAGGGAAACCGTGCTCAGCCACCGGCAACACCGCATCATTGTGCTCACGACGCATTCGATG
GACGAAGCCGACATCCTCGGCGACCGCATCGCGATCCTTGCCGACGGGGAACTGCGCTGCGCTGGGTCGTCCTTGTACCTCAAGCAAACGTTTGGGGCCG
GCTACAACCTCTCGCTCGTCACGACGACCAGCGACCACTTGGCCGACCTCTCGTCGCTCGTCGTGTCGTTTGTTTCTTCGGCAGCCCTCGGCGCGCACGT
CGGCACGGACGTCACGTATCAGCTACCGCTCGAGAGCGCACCGAGGTTCCCCGAGCTCTTTGCCGCGCTCGACGCCCAACGCACGCAGCTCGGCGTCGAG
TCCTACGGCATCTCGGTCACGACGCTCGAGCAGGTGTTTTTGACCGTCGCCGAGGCGCCCAGCACCGACGGTGACGACGGTGACGTCACCCGCAGTCAGC
CCAGTGACCTGTCGCCCACCGTCGACACGTCGTCCGTCTTTCGAATCCTCGAGGCCGCCCCAATGTCCAAGGCCGCTCGGTTTCTTGCGCACTTTCAAGC
ACTGTGGCGCAAGCGCTACTTGTGCGCCAAGCGCGACCGCAAGATTGTGACGTTTTCGACGCTGTGGCCGGCCGTCTACATTGCGATCGGGATGCTGCTC
CTCACGACGAGCGCGACCCGGAAGAACGATCCGCCGATCGAGATGTCGACGCGCGCGTTGCCGCTCGGCGCCGAGACGCCACTGCCGTGGACGTGTCTCG
ACGGGTCGGACGCGTGGTGCGACGGCGTCACACGCAGTATCCGCGCGGCCGCCGCGTCCTCTTTGCCGCTCATCACGTACCCGACTTCAACGCCGACGGT
CTTTGATGTCCCGTACACGATCAACGCCAGCGATACGAGTGGGTACTGCCTCAGCATGGCGCAGACGTCGCTGCCTGCGGTGCTGCCCACCGCATTTGGC
CGTGTGCTTCTCTTTACATCGGCGTCGAGCCAAGTGGTCGGGTACGCGCTCTTGAGCAACACGACTGCGACGCACGCGCCGAGCATCTACAAGGCCGCCG
TTGATGATGCGCTTGTCCGGTGGGTCACACAGACACCGACGGCCACGGTGGTTGTCATGAGCCATCCGCTGCCGCTCACACAAGCCAGCAAACTGCTCTC
GACGACGATCCTCTCGTTCACGGCCACGTCATTCATCGTGGTGGCGATGGCCTACTTTTCAGCGTCGATCGTGCCCTTCCTCGTCCAGGAGCGACATGTG
AGCACGAACGTCAAGCACCAGCAGCTGCTCGCGGGCGTGAGCATTCCGGCGTTCTGGCTGGCCAACCTCGCGTGGGACTGCACCTTGTACTTGGTCCCCG
CGGCGCTGGCGCTCGGAGCGATCCAGATATTTGATATCACGCCGTACACGGGCGTCGACTGCGCGACGTGCGCCACGAACGCGTTCGCAGTTGTCGTTGC
TCTCTTTGTCCTCGCCGGCGTCGCCGTCGTCGGCTTTAGCTACTGCGCATCGTTCCTGTGCAAGGAGCCGGCCGAAGCACAAGGCTACATTATCAACTGC
AACATCTACCTCGGCGTGTACCTCATGCTTGTCTCGACGATCCTCGGGCTCGTCCCGTCCACCGAGTCGCTCAACGACGTACGTTCATCTCTGATGTTAT
GATCCGGAGGGTTCGCTGGGTTGAGTGCGGTTGTAGACGCTGGTGTTTGTGTTCCGCCTCTCGCCCCTCTTCTGCCTCGGCAATGGTCTCTACAGCCTCA
GCCTTCGCGCGATCATCGGTCCGACGTCCGGCACCGTGTCGTCGTCGGCATTTTCGACCGAGAATGCTGGCTGGAGCATTGTCTACTTGGCCATCGAAGC
CATTCTGTACCCAAGCCTCGCCATTGCTATCGACTACCTCCTCTGCTTTCCGTCGATCGCGGCCTCGTGGCGCCGCCGGACCACGCGCGTCAGTGACGAG
CACGACCCAAGCACAATCGACCACGACGTCGATGTTGAAGCCGCACGGGTGCGCGCTGGCAACCATGACGACGCTGTTGTCATGACGTCGCTGCGCAAGA
CGTACCCCGACGGCAAAGTGGCCGTCGCCGACCTCTCCTTGGGTTTGGGCCGTGGCGAGTGCTTTGGTTTCCTCGGGGTATGTGCTCTTGCTTGTCGATA
TTTGCCGAATGCATATGTGAATGCGCGTAGATCAACGGCGCGGGCAAGACGACAACGATGAAGATGCTCACGGGCGACATCCTGCCAACGTCGGGTGCGG
CAACCCTCGGCGGCCACGACCTCCTGTCGCAGCCGCTCGCCGTGCGCCGGCTCATTGGCTACTGCCCGCAGTTTGACGCCCTCTTTGACTTGCTCAGCGT
CCGCGAACACCTCGAGCTCTTTGCTGTGCTCAAGGGCGTGCCAGGTCCCTTGGTCAAGGCCGTGGTCACCGAGAAGCTCTCGCAGTTGCACCTCGAGCCG
TTCGCTACGAAACTCGCCAAGACGCTCAGCGGCGGCAACAAGCGCAAGCTCTCAGTAGCGATCGCTCTCATTGGCGCGCCGCCGCTGCTCTTCTTGGACG
AGCCATCGACGGGCGTCGACCCGGTCTCACGCCGGTACGATGCAGCACATGTACATAGGGCAACTAACTCATCTTTTGTCGCATTAGGTTTCTCTGGAAC
GTGCTCGCCGACCTCTCGACCAAGCGCAAGGCGGCCACGATCTTCTTGACGACCCACAGCATGGAAGAGTGCGAAGCGCTGTGCACGCGCGTGGGCATCA
TGGTCGGCGGCCGGCTTCGCTGCCTTGGCAGCATCCAGCACCTCAAGTCGCGCTTTGG