Description :
From Genome Similarity Track
Location :
Scaffold_451:9170- 13564
Sequence
4394 bases(100 bases per row)
GACCCGTTACACCTGGTAGCACTTCGTAGTCCGTCCAAGGACCACAAACCCGTTCAACATGAACATGTTGGACGACGAGGCGACGACACCTTTCACGGCA
CCCGGAAAAGTCACTCCTATTTGAGCGATGTCGAATGGATTGCGGTCGGACGAATGAGCTCGACCGTTAGCGAAGAAGCTGTCTGGTCTCTGCTATCATC
AATGGATACGGGCCAACAGCATTCCATCATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCGAGCTGAAGTGACCCTGATGCATCAGCATGGTCAC
CTGCAGACTGAGCTCCTGAGACAGCAACAGTCTTAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGT
ACCGGGGAGTCGAGTAAGACTCCTTGTTGAGATGGCTGCTAGAAGTGGACGATTCCATTAAGGCTCCCCATATTAACAATGAAGAATTGCAGGTTGCATT
TGCCGAATCGAATTTGGCAGGGCGTGCCAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGGCGGTCTTTAAGACTCTG
CTCAATCAAACTATTGAGCCGCCAAGAGCTGAGTTCAGTATTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGC
ACGTTCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATCACGAATTCTTACAGGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGTAAGAATATCTATTGA
TGAAAGTTGCTTCAGACTCACAATCCTTGTGTGTCTCTGCACTTGGTGATGAGATATCCCTCATCACCTTGAATTTAGAAGTGACAAAAGATTTGTCATT
TCGTGCCTTAATTGACTGTGGGGCGTCGAACAACTTTGTTCGTCGCCAGTCGCTAGATGATCGTAGTCTCAAGTTCATTGAGTGCATTACTCCTCCTACG
AGGCCGAAGGTGCGCCTCGCAACAGGCGCATCTATAGCAGTGATGAAACGTGTAGTGGGATTTCACTACACGTTCGAAGATTTGCAGTACAATAATGATT
TTATCGTACTTGATTTGGATGACAAATTTAATGTCATTCTAGGGATACCATGGCTCTGAATGTACGAGCCAAAGGTCAGCTGGCAGCATCGAGCCGTGAA
GATGCCTGCCACTTGTTTATTAGATTTCCATCTGATGAACGGCTTGGAGCACAAGCGTGTGGATGTACTGTGAGTGAGTGCGATGGCCTCACTTTCGGTA
CGGTCGTCAGTGTGACTGCACAAGATTACAGTGTGACGACCGATCACATTGTGGAGGAAGCTGCCGGCGGCTGTGCAGATTCACAGACAGCGCCGAAGGT
CTAGCACCCGAACAAGTCGAGTAGATCGGGACATGGGTGTACGCCTAGCGGGCAACATCCAAGTAAGAATAAACGAGTTGCCCAAACAGGTCAACACGAT
GATCCTCGATCGGCTGGAGATTCGATTGTAGAGGACTTAGCTGTGGTAGCGCAACCACAGCTAGTAGACGTCGGGGGAATAATTCCCCACGTACTTGAGG
AAGAAATTCCTCAAGCAGTTATTGGCGAGGTAATGAGACCTCATCAGCTTGAGGGAATAAGTCTCCAGCAGCCTGTGGAAAAGGGTTCTCTGGAAGAAAC
TGAGACATTGAATGTCTTGGTTAATGACGGGTCAAGCGTAGGCGCTTATACACTTGATCTGATCGCGCCTCCGAAGTCGACTTCGGATATCACCGAATTG
CCAACGCTAGAATCGAAACGGTCCTTGCGAGATTTGCGTAGTTGCAAGGTCAAGCGGATCTGTGTACTCGTCAAGGAGGACGAGTACGTGAATGACATTC
GGTCGGCAGTAATATTTGCCGAAAACGAACGGGTTCTCAGCAGCTTAACGATGGACGAAAGTGTCCTCGATGAGAAGACTCGGATTGAGCGATACACGTC
TCAATCTTGGGAGTCGCTTTAGGAAAATCCTTTGTATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAGTCCGTACCATGCGAATTGCCTTAAGAT
AAAGGCACTCGACAAGAAATCGAGCTCAAACCGGGCATGAAGAACTGTGTCATGAAGCAGTGGCCACTGCCTCGTAAACAAGTACTTGCGATCGACAAGT
TCTTTGCCGATCGCTTAGCTGCGGGTAATGTGAGGGAGTCAACTTCCCCTCACAGCTCTTCGAACTTCTGTGTGCGCAAGACCACTGGAGTATGGCGGAT
AGTGCACGTATTCAATAAGGTGAATGCTGCAACGGTACCGGCTCATACGCCGATACCGAGGAAGTACGTAATCATTGATGGCATGTCAAAGAGTACTATC
TTTTCGTCCATGGATCTGATGGATGGATCCTATCAGATTCCAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTAGG
ATTGACTAGTAATGCCACAAGGGATTAGCAACGCCCCTGCCACATTCAACAGATGTGTTACAGATCGGTTGGACTGGTGCGAGGCTTCGCACCGAGTTAC
TTCGACAATGTTCTCGTCCATAGCCGGGCTATGAGAGAAAAGACAGACGTAGAGGTTCATGGAACTCACGTTCGTCAGGTTGTTAAACTTATGCGCAAGC
ATAAGCTGAATGTCAACCTCAAGAAGTGAATATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAACTCGGCTTACGCCCTGATCCAGA
AAAGGTTAAGGGGATTACCGACTGGCCTGTGCCAGTAGAAGTTAAGGAACTAAGAAAGTTCCTTGGTCTATCGGCGTGCTTACACAAGTACTCGCGCAAC
TACGGCAAGATGACCGTTCACCTCTCTCGTCTTTTTCAAAAAGAACGAGAAATGGTCATGGAACGCTGATTGTCATCGTTCCTTTAAAGGCATCAAGCAG
AGCTTGATGCAATCGCCCATCTTGGAGATTGCAGACCAAGACGGACCATTCCATGTGGTCTGTGATGCCAGCGATTTCGCAATTGGCTGCGCGTTAATGC
ATTACGATGTAGACGGAGCAGAACTTGTCACCTGTGATCAATCCCGTCAACTGCAAGTAGCTGAGCTTAAGTATCCAGTGCATGACATGGAACACCTTGC
CATGAAGTATGCACTAGCGAAGTTTCGCGTCTATCTCCTTGGATATAGGCCATTTGTAGTCTGTACGGACCATGCGTCATTGCGCACGGCCGTAAACAGC
CCACACCTTTCGCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAGTACAACTTCTCCGTGGAGTACAAACCCGGACGACTCAATGTCGTCGCGGACG
CGTTGTCGCGCCGACCCGATTTTGAGTCGGCTACGTAGTCCAACAGTGGGGTTAAAACTACTGTTGCAACACTAGTCACTAGTGTCCCGTCGTCAACATT
GCTTGATGACATAAAAAAGGCCTAAGCAGAAGATAAGATTCTTCTGCGACTAATGGATCATCCAGTGACTCCTCTCGTAAATCTCTTAAAGATTTACCAG
CCTTGTATCGATTGTCCGTGGATCGATACACAACACGCAACGGGTTGCTGTATTATACAGCCGTTACAGGCGACACACCTTGTGTCGTCGTCCTCACTCA
TAATGATTTGCTCTTACGCATCATGTATGAGTGTCACGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGACTTT
TACTGGCCCCGCCAGTATCAGTTTGTGCGCAAGTACATTCGTGCTTGTGAATTGTGCCAACGGGTGAAGCCCAGTCCTTCATTCCGTGCGCCACTACAGC
CTCTACCAATCCCGGCTGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTCTTCGGTTTCCCCGAAGATGCTCACAAGAATAATGGTATTCTTGT