Description :
From Genome Similarity Track
Location :
Scaffold_158:917- 5033
Sequence
4116 bases(100 bases per row)
TGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAA
GGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGT
GCAGATAGCTTGGCCAGCGCCGCTTTACGAAATCCATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCCGACTAGAC
GAAGTGGTGGTAGTGGGATCCGGGAAAAGGACAGTCCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCCAACCCCCAAATTCTCGAGGA
AACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGA
GACATGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTAAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAG
TCAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTAACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCA
GGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAG
ACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGC
CCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCAT
TGCTGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCA
TTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCAAAGCTAACGGGTCGACCGAGCGCATGGTACAGACGATCACGAGAGCAC
TCAAGATGTACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAAAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGA
TACCCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTAGAAGTGGCCATTCCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGGCAA
GGGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNN