Description :
From Genome Similarity Track
Location :
Scaffold_1699:917- 3966
Sequence
3049 bases(100 bases per row)
CTTCATGAGACTGCATCACGCCGAATCTGTTACGATTGGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCA
ACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGACCTCATATCGGTGATCTTCTCGACT
TCGAACTCGTCGGCTTTGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGATCGGATCCATCCACCGAAAGACGGATCT
GCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTTACCGCGTG
TTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGC
GATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTT
GCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACCGGAATGGCCGCTTCTAGGGTGGATTTGGG
ATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCC
CTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTG
CTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATGAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCT
TCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAGATC
AACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAAGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACC
CCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGACATACCGTTGTACGCTCTTGAATAGTCCTCCAGTGAAAACATTCCCGGATCCGTT
GGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTACCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCTGGCATCACCAGTCTCATCAA
TCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTG
GCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCGATGC
GGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGA
TCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCATGATGCCCGGCTTCTCTCTCCACTTCGACACCACATTGATTCCGTAAAGCGGCG
CTGGCCAAGCTATTTGCACTAGCATTCCAATCTCGCTTGACATGCAGCAGCTCGTGATTCATCCAACCACGCAGGTGGACCATCACTTTCTGCCGTAACA
GTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTACCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTCTTTGGATCTTGTCCCTT
TAGTAGATCCAAACCCAGCAGTAGCCCGTTTTACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATTAGTGGATCTGGTCCGTACAACTTCCCATCCAGGT
AGTCTCCACAGTATTGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCTGCCTGTACTGTCG
GGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGAC
TCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTTCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCC
GACTTGAACAGCCAGGCTAGCGTAGAGTGCCGCGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGA
GTATCTCCTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGGGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAC
AGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATTACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTTGCGATCCTGTTCCTC
AGCTCTACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTCCGCCTTTTCCGAACTCTGGTCCGTCGTCTCTATCCTGATTGGATCCTCTTTCCGTTGGT
CCCGGGGGGATCCAGCTCCTGTGTTAGGTCTTCTTCTGGCATCTTACTACCTGGACCCCCTCGTGGATCCGATATCTCCAGGGCCAGAGCTTGTTGGATT
TTGATTCGGACAGCTGGAGTGGTCATCGCAGCAAACTCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGTGCGTAATCCTCGATGAACCGACTGT
AGTAGTTAAAACTGCCCAAGAAGGATGCATCGCCCGTAACGACTGCGGG