Description :
From Genome Similarity Track
Location :
Scaffold_491:917- 3358
Sequence
2441 bases(100 bases per row)
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCT
TGCCACACTTCTCACATACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAG
ATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGTAGTGAGACAG
ACCCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCG
TAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTC
GTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCAGGGATTCATCCGATCTGCGGCGAGCGTGGTAGT
ATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCCTGGTGGATCTGCCCAGCTGCCTAT
ACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGGT
CCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCT
GCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGGAGTTGTCTCCATCCACGGACT
CCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTC
GAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAATAGCCTGTGGCCGTCTGGCCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGA
TCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATGACGCGTAGGGTCTACTGGATCCCGAGCCTTCACGC
TCACAGGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCTTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGA
CTCAACCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTCTCTGGTGATGGACT
TAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTC
CGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTTGATCTGGCGTGGATTC
AGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATTCTTGTCTGACCAGCTTGACCTGGATCCAG
CTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGAGTTGGGTTTCGG
TACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGACTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAG
GGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCTAGATCCGGTAGGTCTAGATCAGGATCCACCTCTCTTCTGTCGACAGAGTT
ACTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTTGATCCGACCTCCGACGACGCCTCTTTCCCTGACTCAATCTTCACT
TGAGCATCTTCTTGGGACTCACGGTGAAATCCTGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGGGTAGCGGGATCAGCAAAATCTGCAAGATT
GCTGGATCCAACTTACCAACTGCGCCCAGACACCGACTAAC