Description :
From Genome Similarity Track
Location :
Scaffold_17:916978- 918271
Sequence
1293 bases(100 bases per row)
TATCATTCTATTGCCTGATATATGGGGAGCCAGACCCGTTATTAGCCCATTAGTCGATGACGTGTATTTAAGCGGCCAGGGTGGAAGCCCTGGCTCTAAA
ATAAAGTCAGAGTTGAATTTTCCTTAAATCTGAGACTCAGTCGTCCTGTTGCGAGCTTTATCGACACTATAGTGTAAGCAAGTAGCGGAGTAATACCTGG
CTCGTTACACCTGGTAGCACATCGTAGTTTTTCCAATGGCCAAGTTCGACATGAGCAAAGACCTCGGCCATGCCGCTTTCCCCCATCTCACTCGGATCGA
GTGAGAAGCTCTCCACCGCCTTGCGGCGGTGCCCGGAGAAGCCATCGCTACGTCGCTGCTGCGCTCAGCCACGCCCGGCGAGCAGCGCGCTGCGGCACAA
GAATTCATGGAACGCGAGTGTCAACCCCCTCGCAAATGACGTGAAGCCGTTGGTTTGGAGAGACCGACATCGCCTCGCGGTAGATCAAGGCGGCTTCCGC
GAAGGTCCACTTCTTCCTCTCACGGCTGTCTGCGAAAGTCAAGGAATGGACCCTCGGCAAGATGGTCGTCGACCCCAGTGCCTCCCCCACTCTGGATACC
CTCCAGAGTGACCTTCAGCTTGCGTTCGAGCCGCTGCATTATGAATTCCGAATTCGGGCAGACTTCTTCACCCTTCGGCAAGGCACGATGTCTATGCGCG
ATTACGTCCAGAAGACACATCTCGCGTAGTGTATCGTGTCCGAGCCCATACATTTGGTCTCTCAGGTTCATGTGCTCGTGTTCGGTATGCGCGAAGGCAT
GGCGCGCTACTGCCTTACAAGATCGGATCCCTCTGCACTAGAAGAAGCATTTGCCCTCGCACTACGCGAGGCCTACGTGGCTGCGGCTTTCAACGGTCAC
GCGCTGCCCGATACAGCTCGTGAATCTGCACTCGAGCCCATGGACATCGACACTATCAATGCGACGAACAATTTCAAGCGTAATGTAACGCGTCGGAACG
GTGCTCGGGACGGTAGTTCTCTCACCTGCTTCTGGTGCCGGAAGGTCTGTCATCGCGCGGCGGGAGTGCCGCGCGCCACTCCAGTGCTTTTGCATGTCGA
TGCCGAGCTTATGAGCCCTGACCAGCCAAAAACGGTCAGGGTCAGTCGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGAGTCCCCCAGTAGTAAC
CCAACCTCCTAGCCCTCCTGTGCTACATGGACACTTTGATGCCACCTTTACGCCGACTGATTCAAGGTTGATCATTATCAGTCTTCTTGTCGC