Description :
From Genome Similarity Track
Location :
scaffold_897:9169- 10220
Sequence
1051 bases(100 bases per row)
TCAATGTATGGCTATGTCGAGACTCTACGGTGGCTATTCCCTGATTTTTACGACGCGGAAGAGTGTTTAGCCGTTGCTGTAGATGCTGGGCAAGCCGGTG
TAGTGCAATTTCTAAACCAACGGATGGGAGAATTCGAGAAAGCGCCATATCTTTAAGTTGCCGCTACCAAGGGCTATGCAAACGTACTGGAAGCTGGACA
ACAGTCGTTATGGTTTTGCTCACCCTCTTCACCAAGCACTTAACGGCCACGAGGATCTCATCAAGGCTGTCAACAGGGTTCAAACGCAACTATTTAACGA
TTTGGCTCCGAATACAGCAGAGTGCGGTCAAACTAGTATGGTCAAGCCACTGGTTCGGAAGGGAGGTCATCTTGACGTGATAAAAAGCACTGCTGGCAGA
AAGTAAACTTCCCCAGAGAGAAATTTCACGAGCTTATTTGCGGCAGCTGTAAGTGTTCATTGCGATGTGATCGAATGTCTGCTCAGCCACTTAGCCGAAC
AAGAAGGTGAAGAGGCTGAGAGTGCTCAGACGACAAACAAATATATCGGTGGGGCTTTTAAAGCGGCGGCGAGACGAGGGGGTATCAAGATGGTCAAAAT
TCTTCTGGGGCAGTGTTCTGTTGAGATGTTTGGACGAGAGTTGCGAAAAGCTGGGGCTGCTGGAAAGTTCAGGTGCGAAATTACTGCTAACTGAGTGTGA
GAGAACACATTCGGAGGTCTGTACCTACCGACAGCAGTGGCCCAAAAGGCTGTACAGTGCAGTGATCTCAAAATGGTGAAATGAGGTGCAGCCATGATGA
GTGCTCTTGAAAACAAGGATATAAAAATGTTGGAGTTATTCGCGACGATCAATGGTGTGTATCCGGAGGGGGATCCCTATAAACGTACGGCACTGACACT
AGAAAACAACTGAGCCAGCGATTCCGCCGAGTGCATCCGTCGATCTACTACTGGTGAAATGAACTCTGATGCCAGAAAACAGATTTTCTGCAGCTTGGCT
GCGAGGAGATCCGTGAATATGGCTGATCTTGGATCAACGGGACGGGTTTAC