Description :
From Genome Similarity Track
Location :
Scaffold_990:9168- 10956
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_990-snap-gene-0.7Replication factor C subunit 4

Sequence
1788 bases(100 bases per row)
CATGTTCTCCGCCCGTCCGACCAAGACCAACGCCGTCCCGACGGTGCTGCCTTGGGTCGAGAAGTAGTACGTGAATGTGTCAGTCTCCTGCAGCCAAATG
AATGTCGTGGCGTGAGTGTCTAACGAGCGTGTGGATTGTGGATTATGTAGCCGTCCAAAGAACGTGGACGAGATTTCTCACCAGGAGCACGTCGTCGCGA
CGCTGAGGACGTCGATCGCGAGCGGTCAGTTGCCGCATTTGCTGTTCTACGGACCGCCCGGCACGGGCAAGACGTCGACGATTGTCGCTGTGGCGCGGCA
ACTGTTTGGTCCGGATTTCCGCAAGAACGGGCGCTTTCTGGAGCTCAATGCGTCGGATGACCGTGGCATCAGCGTCGTGCGTGAAAAGGTGAAGGGGTTC
GCGCAGGGCGCTATCAGTGGTTCAAGCACGATGCCGCCGTTCAAGATCATCGTGCTGGACGAAGCAGATTCGATGACTGGCGACGCACAGTCGGCGCTGC
GCCGCATGANNNNNNNNNNNNNNNNNNNNNNGAGAACTACTCGAAGGTCACGCGCTTCTGTCTCATCTGTAACTACGTGAGTCGTATCATCGAGCCCGTG
GCGTCGCGTTGTGCGAAATTCCGTTTTGCGCCGCTCGAGAAAATGTCCATGACGGCGCGCATCCAGTACATTTGCCAAGAGGAGCACGTCGAGTCGAGTG
ACGAAGTGATCGANNNNNNNNNNNNNNNNNNNTCGAGTGCTCGAATGGCGACTTGCGTAAAGCCATCAATTTCTTGCAGAGCGCAAAGCAGTTGTGCGGC
GATGAACCGCTTTCCAAGGACGACGTCATTGCTGTGGCTGGTCTGGCGCCTCCTGAGCTCCTGGAGCTTTTCTGGAAATCCGTGGCATCCAACAGCTTTG
ACAAGATGAAAGTCGAGATTGAAAACATCCTCATGGCCGGGTACCCAGTGCTCACGGTGCTAAAGCAGCTAAGTGACGACGTGCTCACGAATGCCAAGCT
CAGCGACACAAAGAAGGCGAAGTTGTGTCTGCGGATCGCCGAGGCCGACAAGAAGCTTGTCGACGGCGCAAGTGAACACTTCCAGCTCCTGGACGTCGCG
TCGTATATCATGCGCGTCTACCACTCGTCGTGATCCATCCGCTAATATATTGATACAGGAGCAAGAAACACATGCACAACAGAGAGTTGATGAGGGCCGT
CATCTAGCATTTTATAACAAGAAAGAAGCAAGAAATTCCACATGCAGCCCCTCGTTTCAATTTGAATTTCCTCTTCTCTGTAGTTTTCTCTCTCTTTGTT
TAACTTTGTAAGCACAATGTGCATGTTTGCTACTGCTTTGTAAATGGATTACGAGCTAAGCACCTGCGCACCGTTTTCAGTCACGGACGAGAGCTGCACC
CACTCGTGGTCGTTGAGCTGCTTCCAGAACGTGACTTCATCGTCACCGACAGCGACGCTCAGCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACCAGCTTATCCGGTACACGGGGGACCGGAATGTGTGAACGAGCTGCATCTTCCACTCGCCGTCGATCTCGTCCTGGCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATGCCGACGTTCGGGGCCCATGCGACATCGCGTACCCAGTCCTCGTGGCCGCGAAGCGTGTCGTG
GGCCNNNNNNNNNNTTCTCTTGGGCCGCAAGCTGCCAGATCTGCACGGTCGAGTTGACGGAGCCAGTGACCACGCGCTGCACAGGACC