Description :
From Genome Similarity Track
Location :
contig_1:916724- 917784
Transcript NameFunction/comments
g307.t1XP_009530284.1 hypothetical protein PHYSODRAFT_510403 [Phytophthora sojae

Sequence
1060 bases(100 bases per row)
CCTAGGAGGCTTCAAGCACCGTAAAACGCAGCAGCACTTCCACCACGCATCGACACAGGTACCTGCTGTTGGTTTGTGGTAAATTCCTTACAGTTGTGGC
TGACATGAGTGTTTTGCAGACGATTTTATCCAGAGCTCGTCGCAACATGGGCCCCCCACGCTTCCATCGCGAGACACAAACACAGTTGCTGGTGACTCGA
TCCTTGCAGACCCATCGAGAATCTGGCACGCAAATGTCTCGGCGCGACGTCAAGCTGGATGAATCGTTCGACCGGCATGTAACTGCGCGACCGTACTTCG
ACTCGTACCAGCTAGACAGTCTGCGTGAAGACTCGGTGCTACTGATGCAGCGCTTGTGGCGTGGATTTCGCGCTCGACTGTTTGTGTACAACATTCGAGA
GCAGCGTCGTCGCGCGAGTAAACTGGCAGAGATCGAAGCCCAGGAGAACGAGGCGGACGATATTAGCCGCCAGCGCCGTGAAGTAAACCGTCGTATGCAT
CCGAACACGGTGAGCGACTTCGAGGTGCTCTACAATGAGCTGGACAAGTGGCGACTAGTGGAATGCCGCAAGGTGCGCGAGCAAAGAGAGCTGGATCCGA
GTGAGAGGCAGCGAGCGCTTGACGCTATCCTGGCCAAAGAGACCAAACTGCTCCAGACAATCGACCGCCTAAAGTTAACAGCAACAGAAGCAAATCGCAA
GCAGCGCATTGAAGCCATGCTACAGTTCATGGGACGTCCGAAGCAGTGGCAGATGAGTGACGGAGACATCAAGGAGGTTCATACGCCGTTTACCGTGCGT
GCGAAGGAACTCATGGACCTGTACCATGGACTGAGGACGCCACTGAGCTCAGTGGACGAGCGCCTAGACATGCTACTGCACGTTAAATGGACCGTCCAAG
AGTTCGATTGCCCCCTCACACGAGAGCTCGTGGAGCTCATCGACCGCGAAGCTGACATGCTGAGCCGTGGGCGCAAGGAAAAGAGTCTGGAAGGTCTACG
CAAGCGCTTAACGAATCTCTTTCTACAGTTTATCGAGACCCCGGAGTTCAATCCGGAGGC