Description :
From Genome Similarity Track
Location :
contig_1:916635- 917695
Transcript NameFunction/comments
g355.t1RAW35460.1 hypothetical protein PC110_g8265 [Phytophthora cactorum

Sequence
1060 bases(100 bases per row)
CCTAGGAGGCTTCAAGCACCGTAAAACGCAGCAGCACTTCCACCACGCATCGACACAGGTACCTGCTGTTGGTTTGTGGTAAATTCCTTACAGTTGTGGC
TGACATGAGTGTTTTGCAGACGATTTTATCCAGAGCTCGTCGCAACATGGGCCCCCCACGCTTCCATCGCGAGACACAAACACAGTTGCTGGTGACTCGA
TCCTTGCAGACCCATCGAGAATCTGGCACGCAAATGTCTCGGCGCGACGTCAAGCTGGATGAATCGTTCGACCGGCATGTAACTGCGCGACCGTACTTCG
ACTCGTACCAGCTAGACAGTCTGCGTGAAGACTCGGTGCTACTGATGCAGCGCTTGTGGCGTGGATTTCGCGCTCGACTGTTTGTGTACAACATTCGAGA
GCAGCGTCGTCGCGCGAGTAAACTGGCAGAGATCGAAGCCCAGGAGAACGAGGCGGACGATATTAGCCGCCAGCGCCGTGAAGTAAACCGTCGTATGCAT
CCGAACACGGTGAGCGACTTCGAGGTGCTCTACAATGAGCTGGACAAGTGGCGACTAGTGGAATGCCGCAAGGTGCGCGAGCAAAGAGAGCTGGATCCGA
GTGAGAGGCAGCGAGCGCTTGACGCTATCCTGGCCAAAGAGACCAAACTGCTCCAGACAATCGACCGCCTAAAGTTAACAGCAACAGAAGCAAACCGCAA
ACAGCGCATTGAAGCCATGCTACAGTTCATGGGACGTCCGAAGCAGTGGCAGATGAGTGACGGAGACATCAAGGAGGTTCATACGCCGTTTACCGTGCGT
GCGAAGGAACTCATGGACCTGTACCATGGACTGAGGACGCCACTGAGCTCAGTGGACGAGCGCCTAGACATGCTACTGCACGTTAAATGGACCGTCCAAG
AGTTCGATTGCCCCCTCACACGAGAGCTCGTGGAGCTCATCGACCGCGAAGCTGACATGCTGAGCCGTGGGCGCAAGGAAAAGAGTCTGGAAGGTCTACG
CAAGCGCTTAACGAATCTCTTTCTACAGTTTATCGAGACCCCGGAGTTCAATCCGGAGGC