Description :
From Genome Similarity Track
Location :
Scaffold_242:9166- 17369
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_242-fgenesh-gene-0.060S ribosomal protein L13
Pytiw_DAOMBR242034maker-piw_contig_242-snap-gene-0.15Folate-Biopterin Transporter (FBT) family
Pytiw_DAOMBR242034maker-piw_contig_242-fgenesh-gene-0.1CDS Pa_4_9260

Sequence
8203 bases(100 bases per row)
GCATACTGAACGCCAGTGATCGAGAGGACTGGTCCTCCTTGGCGTTGGGGAACCACCAATTTCTTTTGCTGGCCCTTGCTGCCGGCCATCGAGAGGCCAC
AAGTTCCAAATTGACAGCAACTTTCGGAATAACTTCACGCGAAGGTAAATGCGCGACCATGCTACAGAGGCTCTCCATGTGTGTGTGGGTGTGTGGGTGT
GTGGGTGGGTGGTGGTGGGCGTCAGGTGCTCGCTGTCGCTTGTGCACCCGCGGGAGAGCAATGGAGCAAGCGGTGTGAAGGATGACATGACATGGATGAA
CAAGTTGTTAACGTGCTGTGTGTGAATTCATGTGTTTGGGTGTAGTTAATCGAAAATGGTGAAGCACAACAACGTTATCCCGAATGGCCACTTCCACAAG
GACTGGCAGCGTCGCATCAAGACTTGGTTCGACCAGGTAAGACTACCTACTTCATGACAGCGACCCCAAGAGAGAGAGAGAGTGAGAGAGAAAGAGACGA
GTGGAGAGCAAGCGACAGAACAGCAGTGCAGTGCAATGGACGCAGCAGATCAGCCACAGCGGCAGCAGCAACGAACAGCAACATAGAAGACCGAGCGTTC
CGGACAGGACCAACAGTTCTTCGATGGGTGGAACGTACCCAATTGATACAGCGTCCAACGAGAAGCAACCTCAATGGGGATACCACAACACAGACAACCA
TCACCAACTGTAGACGAGCTCACCGGACACCAAGTGCACACTGCCCGGACCCAATGCAACAGCCTTGCCAGCTTCAGCAGCAGCAGCTCCTCCACAGACT
CTCTCACTCGGATCGATCCAGCCACCCGCAGACAGTGCAGGACTATGCCATTAACACTCCCATCTATTTTTTCCTTCCCAACAGGCCGCCAAGAAGAAGT
CGCGCCGTTTGAGTCGCAAGGCCAAGGCCGCCGCCATCGCTCCTCGCCCGGCGGCTGGACTCCTGCGCCCTGCCGTGCACTGCCCGACCGTCAAGTACGC
GTCCAAGGTGCGCGCCGGCAAGGGTTTCACCCTTGAAGAGCTCAAGGAGGCTGGCATCAACCGCAAGACGGCGCTGTCCATCGGCGTCGCCGTGGACTTC
CGCCGTACCAACAAGTCGGTCGAGTCGCTCCAGGCGAACGTCCAGCGCCTCAAGGCCTACAAGGCCAAGCTCGTCGTGTTCCCACGCAAGAACATCAACA
AGCCGAAGAACGGCGACTCGAGCGTCGAGGAGACCAAGAACGCCGTGCAGCACACGGGCGCGCTCTTCCCGATCACGCGCTCGGTCGTCAAGTCCACGAC
CGCGGTCATCACGGACGAGATGAAGGAGGAGAGCGTGTACAAGACGCTGCGCATCGCGCGCGCCGACGCTCGCATCTTTGGCAAGCAGAAGAAGCGTCTC
GCTGACAAGGCCGCCGCCAAGGAATAAGCTGCTTCTTCTTCGCTGACGACGGATGACGCGCGCCACCAGCTCATTTGTGGAACGACTACTGGAACTGAAT
AAAAGCGGAATGTTGGGTGCTACTGCCAATGAACGAAAGGAACCATCTTTGCATTTCACTCCCCCTTGCTCGGTCTTGATGCCTCTCGATATGTAATGAA
GCCATGCTAACACAGCTCTGGTGGCCAGTAAGCTCGCTCATTGACCAGCCAGCAAACGCACGTAGTCCTTACAACACTGTGTACGTTGAGTTGTTATTTC
CATTCTACTTAGACATGCAGCGTGTCATTGCTGATGGCGCCACCACCTCCACGCAAAGATCCTTCCTTTCGCTCGTTATCAAGCGGCAGCAGCGGCAGCT
TCTCGGTGCCAACGTCAAAGCCCTCAATGCCGTCGTACTCCATGGCGACTTTGTCAGGAAGCACACAAAGGAACGCGAGCACGAAGAGCTGACTGCACGC
GGAGATGAGCACGAGCACCCAGAGGTTGTCCCAGTTCACCAACTGCGTCACGGGGTCTGCCTCGATGCCCTGTAGCGTCACGACGCCGGACGTGACGATC
CCGGACACGACGCCGCCAAAGTCCATGAAGGACAGGTAAAGTGCGTACGAGAGGCCATGGACTTCCTTGCTCTTGGGGCAGTAGAACGTGGCGACCACGA
GCAGCTGCAGCAGCGCAAACTCGGACGTGAACGCCGTCACGAACGACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTAAACGTGCAGATGGACACGGGCAGGTGCGCTTGGGCGAGCAGCGGCGGGGCCAAGAGCAA
TCTCGGGAGCCCCGCGATGACCGAGCAAATCGTGGACGCGAAGAAAACTTGGCGCACGTTGCGGCCGCTGCACCACTTGGCGTACATGATGCACGAGAGA
AAGCGGCCGACCATGCCGGCGAGCGACATGTACTGCAGGCACTCGGGCTCGCTCTCCAGCAGCGAGAACGTGTACTGGTACCAGACGCTACCGTCCCCCG
GGAGCGCGTTGCAGAGGAAGAAGAAGAGCATCGTGGGCAGGATGGGCAGCAGCAGGTCGAACTTGCGCACCACGTCGTCCCTGAAGGAGCGCCAGGACTC
GCGCAGACTAGCCCAGAACGACTGGGCGCCCGTGATGGGGGCTCCAGCGTGGAGCGTGAACTGCGGGGCCGACGCTGTGCGGCTCTCGTTGATGCCGAGC
AGGCACACGACGGCCGCGACGAGCGGCATGGCGCTCGTCCAGCAGATCACGGTCGTCGGCTTCACGGCCTTGTTCTTGTACACGGGGATGCCGAGCAGCA
GCGCACCGATGGAGGCCGCGTTCTTGGTGCCGTTCGCGAGCGACTGGACCTTGCCGCTCGTGACGTTCGTCGTGTCCTCGGCCGCGAGGTCGACGAGGAA
GATGCCGAGCATGATCTGTGCAAAGGCCTCGAAGACCGAGTCGAGGATCTTGACGACGAAGGCACCGGCGATCGAGTCCACGAACGCGCCCGTGCAGAAG
AGCGAGAGCGCGGCGCCGATCTCGCACAACACGATGTACGACTTACGGTGGTAGCCCGCGATGGGGAAGTTGTCCGAGACGAGCCCGTAGAGCGGCTTGA
GGTTCCACGGGAAGAACGAGACCGAGTAGTAGATGCTCGTGGTCGCCGGCGGCATACGGATGACCTGGAAGAGCCACTTGCCGTACGCCGTCATGGGGAA
CGTCAGGAAGAATGCGTGCAGGAAATAGAGCGCCAGCAGCCCCACAGGCACGCCCGAGAGCAGCCCCGTCGCAGAGCTGCTCATGCTCATGGTCGGACTT
CGAGGTTGTCAATTTGAATGCCGTGTTGAACCCAGTTACAAACTGTTCTGTCTCTTACGGTACGGTTACTGGAATGTGTCTAGGATTTAACGGTAATAAT
TAATTGAGAGGCAGAGATGTGTACACTACTGTACTTGCATCATTATTTGAGTAGCAGAGAAAAATAATGTTTTGACTCGATTGTACTATGCCATTTTAGA
TCTTTCTGATAGAAGACGGTATAGTGAAATTGAGTGAGATGTGTGGCTGTGAGATCATTGGTGCGGAGCCTCGGCGCGCGCTGATTGGCTGAAAATACCG
AAACGACATGAAGAGCTCTTCATGGACACCACGAAAGCAGCAAGCACTGGGTCGAGAAGCGCGTGGCGTGTGTGTGGCTGATTGAGAGACGACGACATCA
TGGCGAACAAGATCTTCAACGTGGACGACGCTGAGGACTTTGACGACGGCACCAAGGCCGTGACGTACGACGAGGAGCTGGGCTCGTCCGAGTCGGAGAA
CGAGAACGCGCGGCTCTCGACGTCGCGCAAGCAGCGCATCGCGAGCAAGAAGGTCAAGCAGCGCGAGCAGGCGTCATCGCTGCGCGTGAAGAACTGGGAG
GCCGGTGCGCTCGAGAGCGAGGAGTACGCTGGCAAGGTCGTGAAGCGCAAGGACATTGTGTCCGAGGATGAGGAGGAAGACGAAGATGCCGCCATGAACT
CGCCCGATGAGGCCGAGATGGAGGAGTGGTCTGAAGCCGAGCCCTTCGGCGAGTCGGACAGTGAAGGCGATGCTAACGATGACGAAGAGGAAATCGACGA
CGAAGAGAGCGAAGACGAAGTTGATGACGATGGCGACAAGGACGCCGAGAAGCTCATCCGCGGCTTTGAGAAGCAAGACTCGGCGCAGCTGATGAGCTCC
AAGGACAGCGCCAAGCTCGTGGAGAAGGCGCTTCACGTGCGTAATCAGAAGATCCTTTGGGAGCGCTGTCTCGAAGTGCAGATCCATACGAAGCGACTGC
TGTCGACCACAAAGACTGCGAGTGCCGCCGTGCCGGAGGCGGACGATGAGGACGAAGAAGCCAGTGCCCAGAAGAAGGCGCAGGCCATCGCGGAGATCTA
CTCGTGCATCGACGCCGTGTCGAGCCTGCAAGATACATTATGCAACATCCCTGAGCTCGCGTCCTCGAGTGACGCCAGCAAGAAGCGCAAGCGCAACGTG
GACGACCTGTGGAAGGAGATGCAGGACACGAATCAGACGATGCTGCCACAGTACAACGATATTCTCAATACATACACACGCAAGACCAACCTGGCGGGCG
GCAGCCAGGCGAAGAAGTTCAAGGCTGTGAACCAAGACATTCTCGCGCAGGTCGAGTCCGTGCTCGCAGACACCCAGCGCGTCAAGCGGAAAGCGCACGC
GCCTCTGGATGTCGACAACGGCACCACCAGCGCCGAAGAAAGCTCAGAGGACCTCCTCGACGAGCTCATGTACGACGACTCAGACTTCTACCAGCAGCTG
CTCAAGGAGTTCATCGAGAGCGGTGGCGGCAGCGGCCAGGACGCGCTGCAGCAGCGAACACACCGCAAGAAGAAGAAAATCGTCAACCGCAAGGCCAGTA
AGGGCCGTCAGCTTCGATACACCGTGCACCCAAAGTTGGAAAACTTCATGTTCCCAGACCCGTTCCCGAAGCCAGAGATGGACGCCGACGAGCTTTTCCG
CTCCTTGTTTGGCCAGGTGACTCGAGCCTAGAATGAATCAGTGTCTGGCAGCATAGAAGAGAGACGCCCATATTATAGATAACAATGATGAACAATTTGC
AAACCTTGGGTGCGTATTTGCAGTTCTCCAGCTTGATCATCAATTTTGGTCTCTTCCCCTACAGGACGTCGTCCTCTTCTTCGTCTTCTTGCTGGCCCAA
GACGTAGATTTCCTTCAATTCGCCCACCTTGCTGTCGATCTGTGCGAGTCGCCCGCCATCCACACCACGAGCGCCGAGTTTCTTCACAATCCCGACGAGC
TGGATGGCTTTCTCACTCACGTGGATGGCGGAGTGTGCGCGAATTTTTTTCGCTCGCGTGGTCGTCTCAAGCAAGCGGAATTCTTCTTCAGCAAGATCCA
TGGCAGCGCTAGCAAGCACAGTCGATGCATCAATGAGCTCAGTACCCCGCTCTTCAAATGATTCAGGGACGCCATTTTCCTGAAGTCGCCTCAGCTCAGC
GGCGTAAAAGTTGCTCTTGAACACTTTGTGCTTGAGCTTGACAGAATCCTTTAACAGCTGGGTGAACTTGTCGATCAGCTCTGGTTTGCTCTTCACACTT
GCACGAAGAGTCACGGGGGCGTTGATGATCTGGGCTCGCTTCGATATCAATTGGCCGGCATCGCGATCAAGGAATGACAGCGACCACAAGCGATTGTAAG
CCTTGCCAGCATCCAAGCGTTCTTGCTCCGAGAAGTACCAATCCCGAGTATCCTTGTTCTTGATCAGCAATCTATTCAAAAGGGATGCAGGAGTTAGCAA
TGGGCCTGCAAGTAGAACACCAATGGAATGAAGCAAAGTTACTCACCTCGCGGACCACGTCTGCACAGCATCCGAACCCAACGAAAGTCCGAGCTCTTCC
AGCTTTGGACAAATCTCACTGTAGTACTTGATCGCTTGCTCATCTGTGGATAGCTTCTTTGCCAGGAGCTCAGCGATGGCTTGATTCACCCCGTCTAGGT
TCTCCACAAGCTTCTTGTTGCTGTCTTTCCGGGCCTTTTTCTCCAGCTGCTCGATCATGCTCATTCCACCAAGTCCCTTCGTTGTTTGCTGCTCGTCACC
AAAGATGTCGTCTATTGCGCTCTCAGCATCAGCGAGCTCGCGCGCCATTTGATCTTCAACAGATCTCGGTGGCATGAAGCCGTCTGGGCCTCCACTGCCG
CTAGAGCTTCGACCATTACCGGAATGAAGACCACCACTAGAGACTACAGACACCCACACAAAGCTTAGTTATCAAATATGCAGGGTTGTAGACCACGCAA
ATACGAGCTACACGTACCATTTTGGATGATCTGCTGGTGCTGCATGAGGATGCTAAATAGTTGTTCCATCGAAACAGGTCCGGTTGAGCCTTCAGGCACC
TTGGGAGGCTAGATGACACAGCCAACACAATACTCGGTTAACAAATTGCCACGAGCATAAGCTTTTGCAGATATGTCATAGAACGTACGCCAGGGTCGTT
GGGGGAGACTTCGTCCGGGCGGTCCAAGATCGTAGGGTCCAACTCTTCAGCAGCCATCTTCATCTTCGCTTGTTCGATTGGCATCCCCATTTGGAGCAGC
TTGAAGTATTTTTTGAAAGCTGGATCATCCTTAACCAGCAGAGGAACGTAGGGTGGCGCTGGAACAGAGGATATCTGCGGAAGAAGACCAGCTGGAAAGA
CTGGCATGTTCATTCTCATCGCACTGTGATCGACCGGTTCTGGAGGCTAGAGTTGTTCAAGCAAGCACGTCAGAGCTTGGCACACCAAAACATAAATAGT
GTAAATAAGTGACGAGTATCGCTTACACCAGGGTCGTTAGGAGACACTTGGGTTGGTTGGTCCAGCAGGTCGGCGTCCACGCCATCCGCTTCCATCTTGA
GTTTGATTTGGTCGATGGGCATGTTCATGTTTTTCAGCTTGAAGTACTTCTTGAAAACAGGATCATTCCCAACAGTAAGAGGAATGTAAGCACCTGGCGC
TGGCTGAACTTACATAAACACCAGCACAGATCCAAAATCATGTCAGTGGCAAACTTTCAACAACAACAAGAGGAATCACTGGCAACAAACAACGTACCCC
AGGGTCGTTTGGTGAGACCTCGTCCGGAGTGTCCAAGAGCGCCGGGTTCACTCCATCACCTTCCATTTTCGCCTTGATCTGCTCTGCTGGCATCGCCATC
TCCTTCAACTTGAAGTACTTGCGGAATTCTGGATCGTCTTTCACCAAAAGCGGTCTGTAGATTCGCTGCACGCCGCCCATGTGACTGCCTCCAGGGGACA
TATTCTGTGTCTTCTTCTCCAGTTCAAGCAGCTTCTTCTGCAGATCTTTGATATCCTTGAGCTTCACAGGCGCAGAGCTGGAAGTTGTGCGATCGCGGAT
CGATGGCTCTGCCGACACTTTCGACTGCGCCTCGATGAGTTTTTCAATCTGCGACTGCAGCTGCCCAATCACTTTCGTGTCTGCCATGTTATCCGACTTG
GACGACAGCTCCAGAAGTTTCTTGATCTGCGACTCGGTGAGTCCCGGGATCTGGAAGCCACTCATGCTCGCGCTCGGTCCACTGGAGCGTCGCGAGCTCT
GCGACGATGAGCGCGTGACGGCCGCGTGGGCCACGTTCTCGCTCTCCTCCTCGCTCTCTTCCTCCTCCGACGAGTCCTCTTCCTCCTCGCTCTCCTCTTT
CTGCATTCGTGCTGCACAATCGCACCCACATAACAGCGCACATTAGCTCCTGCCGCCACGTTGGCAACCGAATAAAAAGTGCCAGTCGTCACGTACCAGT
GATGCAGAATGCGCGATGCGATTTCGCATTACGACGCAGACACGTCTACAGAAGAGAGCACACACAAATCCACATACCGTCAGCCCATACCCACCACAGA
GCGAGCATACACATAGTGATAAAAACACAAGGACTGTCGCACCTCGTTGCAGTAGTGTGCTGAGTGGCAGATCGTGCAGACCGTCGTGGCGTGCGGCTGG
CCGCAGTGCACGCAGTCCTCGCCGCGCGCGCGCATGTTGGAGGCCATGACGGCACTCGTGAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCA
TCG