Description :
From Genome Similarity Track
Location :
scaffold_6:91630- 94011
Transcript NameFunction/comments
g404.t1 hypothetical protein PHYSODRAFT_286376

Sequence
2381 bases(100 bases per row)
CAGTATTGATAACTGTACATGTATCGATAACTGTCTACTGGTAGTGCAATGCACCACACGAGCATTCTCGATCTGTTCGTCGCTATTGAACACGTAACTT
ACCCGTACGTGGCATATCTTCGCACTTAATTGGGCATCAACGACGCGTGGCAATCGTTGACTTGTTTCCTGTATGTCCCATACAAACATGCAGTCCATTC
TAAGCGGGTTTCTAGAAGACCCATTTTCTCGAAACCCGCGCCAGGCCACGTCAGCACTGCATTACACCTGAAACGACTATACTGCCTTGTATTCGAAGCG
TACAAGCCCACCGATCTTTGACTTCCACGCGTTGCACCCCCCAACCAGCCTGTCATTATCGTTTTAGCAGCGAGAAGCTAAGGATGAACCTGACCAAGAT
TATCCTCATGGCGGCGGCCGCCTTTGCCGGCGCCGTGGTGGCCGACGACACCAAGGGCCCGCGCGGCCCCGTGATCGGCATTGACCTGGGCACGACCTAC
TCGTGCGTGGGCATCTACAAGGACCAGAAGGTGGAGATCATCGCCAACGACCAGGGAAACCGTATCACGCCCTCGTACGTCGCCTGGGACTCGAACGACG
AGCGTCTGATTGGTGACGGTGCCAAGAACCAGGCCACTATCAACCCGGAGAAGACGCTGTTCGACGTCAAGCGTCTAATCGGCCGCAAGTATAGCGACAA
GTCAGTACAGGCCGACAAGAAGCTGCTGCCGTACGAGATCATCAACAAGGAAGGAAAGCCTTTCATCGAGGTGGACGTCAAGGGCGAGAAGCGCCAGTTC
GCCCCCGAGGAGGTGTCGGCTATGGTGCTTACCAAGATGAAGCAGATCTCGGAGGGTTACATTGGCCGTGAGGTGTTCGACGCCGTCGTGACGGTGCCCG
CCTACTTCAACGACGCCCAGCGTCAGGCTACCAAGGACGCTGGTACCATTGCCGGTCTCACTGTGCAGCGTATCATTAACGAGCCCACGGCTGCTGCCAT
TGCCTACGGTATTGACAAGAAGGCACAGGGCGAGAAGAACGTGCTGGTCTTCGACCTGGGCGGTGGTACCTTCGATGTGACGCTGCTTGCCATTGATGGC
GGTGTGTTCGAGGTCCTGGCCACCAACGGTGACACCCACTTGGGCGGTGAGGACTTTGACCAGCGTATCATGCAGTACTTCATCAAGAAGTGGAAGAAGG
ACAAGAACCTCAACGTCGCGTCGGACAAGCGTGCCCTGCAGAAGCTCCGTCGTGAGGCCGAGCGTGTCAAGCGTGCCCTGTCGGCCCAGGCCCAGGCTCG
TCTTGAGATTGAGTCTCTCCTGGACGGTGAGGACTTTACGGAGTCTCTGAGCCGTGCCCGTTTCGAGAAGCTCAACGAGGACCTGTTCAAGAAGACCCTC
GGCCCCGTCGAGAAGGTGATGAAGGACGCCGACCTTAAGAAGTCGGAGGTGGACGAGATTGTGCTGGTGGGCGGTTCTACCCGTATCCCCAAGGTGCAGC
AGCTGATCAAGGACTACTTCAACGGCAAGGAGCCCTCGCGTGGTGTGAACCCCGATGAGGCCGTTGCCTACGGTGCTGCCGTGCAGGGCGGTATCCTGGG
CGGCGAGCAGGACGACCTGACCAAGGACGTGCTTCTGATTGATGTGGTGCCTCTGTCCCAGGGTATTGAGACTGTGGGTGGCGTCATGACCAAGCTGATC
AACCGTAACACTGTGATCCCGACCAAGAAGTCGCAGACTTTCTCCACGTACCAGGACAACCAGCCCGCTGTGCTGATCCAGGTGTTCGAGGGTGAGCGTG
CTATGACCAAGGACAACCGTCTTCTGGGTAAGTTCGAGCTCACTGGCCTGCCGCCCGCCCCGCGTGGTGTGCCCCAAATTGAGGTGACGTTCGAGATCGA
CGCCAACGGTATCCTGCAGGTGTCCGCCGAGGACAAGGGCACGGGCAAGGCTGAGACGATCACGATCACTGCCGAGAAGGGCCGTCTGTCCCAGGAGGAG
ATCGACCGCATGGTCCAGGAGGCTGCTGAGTTCGCCGACGAGGACAAGAAGGTCAAGGACCGCATTGATGGCCGTAACGCTCTGGAGGGCTACCTGTACA
GCCTGAAGAACAACGTCGAGGAGAAGCTTGAGGACAAGATCGACGAGGACGACAAGGACACGGTCCTCACTGCCGTGCAGGATGCCATGGACTGGCTCGA
GGACAACCAGGAGGCCGACAAGGAGGACTTCGAGGCGAAGCAGAAGGAGGTCGAGAAGCTTGTCAACCCTATCATGTCGAAGGTCTACCAGGGTGGTGCT
GGCCCGGAGGGCGAGGACGACTACGATGACGACGATGAAGATGACGAGCACGACGAGCTGTAGATGAACAAGCTTGAATCG