Description :
From Genome Similarity Track
Location :
Scaffold_755:9163- 11469
Sequence
2306 bases(100 bases per row)
AGCCAATCAAATCGCTTCATTGTGATTGCGGGACTATGACCATCATTCCGTCGTCTCACATGAGCGGCTCAGGTGCGTGGCCCTGGAGGAATTGGGCCAT
TCGCCATTCGACCATGTCGCTGCTTCAGGGCCGTCGCGTGCTGCTGCGGGGGCTGCGGCACCTCGACCGCCGGCAGCCGTGGAAGAACCCGCTGGTCGTC
TCGCGGCTGCCGACGGGCTACAGCGGCCCTCCCCGTCTAGGTCTAGAACACCACCAGCGTGGCGTGCTCAGCTTTGCGACGTCGGCTCTCGACGACGAGG
CCCAGCACAAGCAACGGCAGCAAAAGGAGCGCGAGGAGAAGGCCAAGCTCGAGGCGCTTGCCAAGGTCGTCAACGCCAAAGAGAAAGACATGACCAAGCA
GATCTTGACGTTCCTGCTGCGCCATTTGTGGNNNNNNNNNNAACTGGGCAACGCCATCTTCTCGAGCGTCACGCAGAAGACAATTCGATCGGTCGCCATT
CGCATTTTCGACCACCTCCACGCGTTGGATCTCAAATTCCACTTGAACCGGCAGACGGGCGCGCTCGCGCGGACAATCGACCGCGGCTCGCGGTCCATTG
ACACAGTGCTCCGGTCCGTGGCGTTCCGTGTCGCGCCCACGGCACTCGAGGTCGGTCTCGTGTCGGTGATCATGGCACAGAACTTTGGACTGCCGTACGT
AGGCGTGACGCTTGGCACAATCTCGGCCTACACGGCGTTCACGGTCGTCGTGACCCNNNNNNNNNNCGCACTCGTCTTGGGCTATGGCGCCGCGCGCTTT
GGCGCGAACGCGTCCTCGGNNNNNNNNNNCCCAACGAGAAAACGCCCGAAGCGCGCGAGATCAAGCAGCGCGTGCTGCTCTCGGCCGGACTCGTGCTTGC
GTCCAAGGCGCTCACGATCCAAGTGCCGTTCCTCTTCAAGGAGCTCGTGGATTCCATGAGCATCGCGTCTTCGGTCGTCTCGCAATCGCCCGAGGTCGCG
GTGCCGCTTGCACTCGTCATGGGGTACGGCGCCGCGCGTTTTGGCGCGAACGCGTCCTCGGNNNNNNNNNNAGTGGCGCGACGAGATCCGCCGGCGCATG
AACCAAGCCGAAAACGAGGCCGCCGGCAAAGTGATTGACTCGCTCATGAACTACGAGACGGTCAAGTACTTCAACAATGAAGCCCACGAAGGTGCACGAT
ACGACGACTCGCTCAAGGCCTACCAGCAGGCCGCGCTCAAGACGCAGACGTCGCTCTCGCTCCTCAACGCTGGGCAGAACGGGATCTTCAGTATCGGTCT
CACGGCCATCATGTACATGGCGAGCCAGGGCATCGCTGCCGGTGAGCTCACGGTGGGGGACTTGGTCTTGGTCAACGGACTGCTCTTCCAGCTCTCGATC
CCGCTCAACTTTATCGGCATGCTGTACCGCGAAGTGCGCCAGTCGGTGACCGACATGGAGGCCATGTTCAAGCTGGGCACGGTCCAGTCGACGATCACGT
ACAACCCGGAGCCGCTGCGGCTCACGGGCAGAGAGCCAAAGTCGATCGAGTTCCGTGACGTGCAGTTTGCGTACCGCCCGGATTACCCCATCCTTCGCGG
TGCGTCGTTCAAGGTCGAGGCCGGCAAAACCGTCGCGATCGTGGGCACGAGCGGCTCGGGCAAGTCCACGGTGCTTCGCTTGCTGTATCGGTTTTACGAC
CCGCAGAGCGGTACCATTCTCATTGATGGCAAGGACGTACGGGACATTGACCCGCACGATCTCCGCCGCGCGATCGCGACCGTGCCTCAGGACACGGTGC
TGTTCAACGACACCATCTTCTACAACATCAACTACGGCCGCCTGGACGCGACCAAGGACGAAGTGCTCGAGGCCGCGCGTGTGTCGCAGATCCACGACTC
GATCCAGAAGTTCCCCAAGGGCTACGAGACCCGCGTCGGCGAGCGCGGGCTCAAGCTCTCGGGCGGCGAGAAGCAGCGCGTGGCGATCGCCCGCGCCATG
CTCAAAGACGCGCCGATTCTGCTCTTTGACGAGGCCACGAGTGCGCTCGACTCGGAGACCGAGTCAGAGATTGTGCGCGAGTTTGAAGCCATGGGCGCGA
ACCGCACGGCCATCATGATTGCCCATCGCCTCTCGACCGTGCAGGACGCGGACGAGATCCTCGTGTTTGACAAGGGCGTCGTGGTCGAGCGCGGCACGCA
CGTCGAGCTGCTGCGGAACAAAGGCGGCAAGTACAGCGAGATGTGGGCTCGCCAGAACAACCACGGGGTGCCCTCCAAGCCCGTCGCGGTCACCCACACT
GATTAA